ID: 1117375352

View in Genome Browser
Species Human (GRCh38)
Location 14:55113914-55113936
Sequence ATAAGTCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117375352_1117375359 9 Left 1117375352 14:55113914-55113936 CCTCCCAAAGTGCTGGGACTTAT No data
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data
1117375352_1117375357 -1 Left 1117375352 14:55113914-55113936 CCTCCCAAAGTGCTGGGACTTAT No data
Right 1117375357 14:55113936-55113958 TAGGCATGGACCACCATGCCTGG 0: 11
1: 683
2: 9325
3: 39090
4: 92033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117375352 Original CRISPR ATAAGTCCCAGCACTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr