ID: 1117375354

View in Genome Browser
Species Human (GRCh38)
Location 14:55113917-55113939
Sequence CCCAAAGTGCTGGGACTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117375345_1117375354 9 Left 1117375345 14:55113885-55113907 CCTGAGCTCAAGTGATCTGCCCA No data
Right 1117375354 14:55113917-55113939 CCCAAAGTGCTGGGACTTATAGG No data
1117375347_1117375354 -10 Left 1117375347 14:55113904-55113926 CCCACCTTGGCCTCCCAAAGTGC No data
Right 1117375354 14:55113917-55113939 CCCAAAGTGCTGGGACTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117375354 Original CRISPR CCCAAAGTGCTGGGACTTAT AGG Intergenic