ID: 1117375356

View in Genome Browser
Species Human (GRCh38)
Location 14:55113922-55113944
Sequence AGTGCTGGGACTTATAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117375350_1117375356 -9 Left 1117375350 14:55113908-55113930 CCTTGGCCTCCCAAAGTGCTGGG No data
Right 1117375356 14:55113922-55113944 AGTGCTGGGACTTATAGGCATGG No data
1117375347_1117375356 -5 Left 1117375347 14:55113904-55113926 CCCACCTTGGCCTCCCAAAGTGC No data
Right 1117375356 14:55113922-55113944 AGTGCTGGGACTTATAGGCATGG No data
1117375348_1117375356 -6 Left 1117375348 14:55113905-55113927 CCACCTTGGCCTCCCAAAGTGCT No data
Right 1117375356 14:55113922-55113944 AGTGCTGGGACTTATAGGCATGG No data
1117375345_1117375356 14 Left 1117375345 14:55113885-55113907 CCTGAGCTCAAGTGATCTGCCCA No data
Right 1117375356 14:55113922-55113944 AGTGCTGGGACTTATAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117375356 Original CRISPR AGTGCTGGGACTTATAGGCA TGG Intergenic