ID: 1117375359

View in Genome Browser
Species Human (GRCh38)
Location 14:55113946-55113968
Sequence CCACCATGCCTGGCTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117375353_1117375359 6 Left 1117375353 14:55113917-55113939 CCCAAAGTGCTGGGACTTATAGG No data
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data
1117375348_1117375359 18 Left 1117375348 14:55113905-55113927 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data
1117375350_1117375359 15 Left 1117375350 14:55113908-55113930 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data
1117375347_1117375359 19 Left 1117375347 14:55113904-55113926 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data
1117375352_1117375359 9 Left 1117375352 14:55113914-55113936 CCTCCCAAAGTGCTGGGACTTAT No data
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data
1117375355_1117375359 5 Left 1117375355 14:55113918-55113940 CCAAAGTGCTGGGACTTATAGGC No data
Right 1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117375359 Original CRISPR CCACCATGCCTGGCTAAAGC TGG Intergenic
No off target data available for this crispr