ID: 1117376548

View in Genome Browser
Species Human (GRCh38)
Location 14:55123167-55123189
Sequence GAAGTCTTTCCTGGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117376548_1117376560 15 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376560 14:55123205-55123227 CCAGCAGTGTGGGAATCAGTGGG No data
1117376548_1117376556 4 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data
1117376548_1117376564 28 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376564 14:55123218-55123240 AATCAGTGGGTGGGCAGTGTGGG No data
1117376548_1117376561 18 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376548_1117376558 14 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376558 14:55123204-55123226 GCCAGCAGTGTGGGAATCAGTGG No data
1117376548_1117376557 5 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376557 14:55123195-55123217 GAGTTGTAAGCCAGCAGTGTGGG No data
1117376548_1117376562 19 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376562 14:55123209-55123231 CAGTGTGGGAATCAGTGGGTGGG No data
1117376548_1117376563 27 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376563 14:55123217-55123239 GAATCAGTGGGTGGGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117376548 Original CRISPR GAAGTCTTTCCTGGGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr