ID: 1117376555

View in Genome Browser
Species Human (GRCh38)
Location 14:55123192-55123214
Sequence ACACTGCTGGCTTACAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117376555_1117376561 -7 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376555_1117376560 -10 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376560 14:55123205-55123227 CCAGCAGTGTGGGAATCAGTGGG No data
1117376555_1117376562 -6 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376562 14:55123209-55123231 CAGTGTGGGAATCAGTGGGTGGG No data
1117376555_1117376564 3 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376564 14:55123218-55123240 AATCAGTGGGTGGGCAGTGTGGG No data
1117376555_1117376566 13 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376566 14:55123228-55123250 TGGGCAGTGTGGGATTCAGTGGG No data
1117376555_1117376563 2 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376563 14:55123217-55123239 GAATCAGTGGGTGGGCAGTGTGG No data
1117376555_1117376565 12 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376565 14:55123227-55123249 GTGGGCAGTGTGGGATTCAGTGG No data
1117376555_1117376567 14 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376567 14:55123229-55123251 GGGCAGTGTGGGATTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117376555 Original CRISPR ACACTGCTGGCTTACAACTC AGG (reversed) Intergenic
No off target data available for this crispr