ID: 1117376556

View in Genome Browser
Species Human (GRCh38)
Location 14:55123194-55123216
Sequence TGAGTTGTAAGCCAGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117376549_1117376556 3 Left 1117376549 14:55123168-55123190 CCAGCTTCCCAGGAAAGACTTCC No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data
1117376546_1117376556 9 Left 1117376546 14:55123162-55123184 CCAACCCCAGCTTCCCAGGAAAG No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data
1117376547_1117376556 5 Left 1117376547 14:55123166-55123188 CCCCAGCTTCCCAGGAAAGACTT No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data
1117376551_1117376556 -5 Left 1117376551 14:55123176-55123198 CCAGGAAAGACTTCCCCCTGAGT No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data
1117376548_1117376556 4 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data
1117376550_1117376556 -4 Left 1117376550 14:55123175-55123197 CCCAGGAAAGACTTCCCCCTGAG No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data
1117376543_1117376556 29 Left 1117376543 14:55123142-55123164 CCTCGCAGGGAAGGTGCAGCCCA No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data
1117376545_1117376556 10 Left 1117376545 14:55123161-55123183 CCCAACCCCAGCTTCCCAGGAAA No data
Right 1117376556 14:55123194-55123216 TGAGTTGTAAGCCAGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117376556 Original CRISPR TGAGTTGTAAGCCAGCAGTG TGG Intergenic
No off target data available for this crispr