ID: 1117376561

View in Genome Browser
Species Human (GRCh38)
Location 14:55123208-55123230
Sequence GCAGTGTGGGAATCAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117376547_1117376561 19 Left 1117376547 14:55123166-55123188 CCCCAGCTTCCCAGGAAAGACTT No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376553_1117376561 -5 Left 1117376553 14:55123190-55123212 CCCCTGAGTTGTAAGCCAGCAGT No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376549_1117376561 17 Left 1117376549 14:55123168-55123190 CCAGCTTCCCAGGAAAGACTTCC No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376552_1117376561 -4 Left 1117376552 14:55123189-55123211 CCCCCTGAGTTGTAAGCCAGCAG No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376546_1117376561 23 Left 1117376546 14:55123162-55123184 CCAACCCCAGCTTCCCAGGAAAG No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376555_1117376561 -7 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376550_1117376561 10 Left 1117376550 14:55123175-55123197 CCCAGGAAAGACTTCCCCCTGAG No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376548_1117376561 18 Left 1117376548 14:55123167-55123189 CCCAGCTTCCCAGGAAAGACTTC No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376551_1117376561 9 Left 1117376551 14:55123176-55123198 CCAGGAAAGACTTCCCCCTGAGT No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376554_1117376561 -6 Left 1117376554 14:55123191-55123213 CCCTGAGTTGTAAGCCAGCAGTG No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data
1117376545_1117376561 24 Left 1117376545 14:55123161-55123183 CCCAACCCCAGCTTCCCAGGAAA No data
Right 1117376561 14:55123208-55123230 GCAGTGTGGGAATCAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117376561 Original CRISPR GCAGTGTGGGAATCAGTGGG TGG Intergenic
No off target data available for this crispr