ID: 1117376565

View in Genome Browser
Species Human (GRCh38)
Location 14:55123227-55123249
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117376554_1117376565 13 Left 1117376554 14:55123191-55123213 CCCTGAGTTGTAAGCCAGCAGTG No data
Right 1117376565 14:55123227-55123249 GTGGGCAGTGTGGGATTCAGTGG No data
1117376552_1117376565 15 Left 1117376552 14:55123189-55123211 CCCCCTGAGTTGTAAGCCAGCAG No data
Right 1117376565 14:55123227-55123249 GTGGGCAGTGTGGGATTCAGTGG No data
1117376550_1117376565 29 Left 1117376550 14:55123175-55123197 CCCAGGAAAGACTTCCCCCTGAG No data
Right 1117376565 14:55123227-55123249 GTGGGCAGTGTGGGATTCAGTGG No data
1117376551_1117376565 28 Left 1117376551 14:55123176-55123198 CCAGGAAAGACTTCCCCCTGAGT No data
Right 1117376565 14:55123227-55123249 GTGGGCAGTGTGGGATTCAGTGG No data
1117376559_1117376565 -1 Left 1117376559 14:55123205-55123227 CCAGCAGTGTGGGAATCAGTGGG No data
Right 1117376565 14:55123227-55123249 GTGGGCAGTGTGGGATTCAGTGG No data
1117376555_1117376565 12 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376565 14:55123227-55123249 GTGGGCAGTGTGGGATTCAGTGG No data
1117376553_1117376565 14 Left 1117376553 14:55123190-55123212 CCCCTGAGTTGTAAGCCAGCAGT No data
Right 1117376565 14:55123227-55123249 GTGGGCAGTGTGGGATTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117376565 Original CRISPR GTGGGCAGTGTGGGATTCAG TGG Intergenic