ID: 1117376566

View in Genome Browser
Species Human (GRCh38)
Location 14:55123228-55123250
Sequence TGGGCAGTGTGGGATTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117376554_1117376566 14 Left 1117376554 14:55123191-55123213 CCCTGAGTTGTAAGCCAGCAGTG No data
Right 1117376566 14:55123228-55123250 TGGGCAGTGTGGGATTCAGTGGG No data
1117376553_1117376566 15 Left 1117376553 14:55123190-55123212 CCCCTGAGTTGTAAGCCAGCAGT No data
Right 1117376566 14:55123228-55123250 TGGGCAGTGTGGGATTCAGTGGG No data
1117376550_1117376566 30 Left 1117376550 14:55123175-55123197 CCCAGGAAAGACTTCCCCCTGAG No data
Right 1117376566 14:55123228-55123250 TGGGCAGTGTGGGATTCAGTGGG No data
1117376552_1117376566 16 Left 1117376552 14:55123189-55123211 CCCCCTGAGTTGTAAGCCAGCAG No data
Right 1117376566 14:55123228-55123250 TGGGCAGTGTGGGATTCAGTGGG No data
1117376551_1117376566 29 Left 1117376551 14:55123176-55123198 CCAGGAAAGACTTCCCCCTGAGT No data
Right 1117376566 14:55123228-55123250 TGGGCAGTGTGGGATTCAGTGGG No data
1117376559_1117376566 0 Left 1117376559 14:55123205-55123227 CCAGCAGTGTGGGAATCAGTGGG No data
Right 1117376566 14:55123228-55123250 TGGGCAGTGTGGGATTCAGTGGG No data
1117376555_1117376566 13 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376566 14:55123228-55123250 TGGGCAGTGTGGGATTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117376566 Original CRISPR TGGGCAGTGTGGGATTCAGT GGG Intergenic