ID: 1117376567

View in Genome Browser
Species Human (GRCh38)
Location 14:55123229-55123251
Sequence GGGCAGTGTGGGATTCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117376551_1117376567 30 Left 1117376551 14:55123176-55123198 CCAGGAAAGACTTCCCCCTGAGT No data
Right 1117376567 14:55123229-55123251 GGGCAGTGTGGGATTCAGTGGGG No data
1117376559_1117376567 1 Left 1117376559 14:55123205-55123227 CCAGCAGTGTGGGAATCAGTGGG No data
Right 1117376567 14:55123229-55123251 GGGCAGTGTGGGATTCAGTGGGG No data
1117376554_1117376567 15 Left 1117376554 14:55123191-55123213 CCCTGAGTTGTAAGCCAGCAGTG No data
Right 1117376567 14:55123229-55123251 GGGCAGTGTGGGATTCAGTGGGG No data
1117376553_1117376567 16 Left 1117376553 14:55123190-55123212 CCCCTGAGTTGTAAGCCAGCAGT No data
Right 1117376567 14:55123229-55123251 GGGCAGTGTGGGATTCAGTGGGG No data
1117376555_1117376567 14 Left 1117376555 14:55123192-55123214 CCTGAGTTGTAAGCCAGCAGTGT No data
Right 1117376567 14:55123229-55123251 GGGCAGTGTGGGATTCAGTGGGG No data
1117376552_1117376567 17 Left 1117376552 14:55123189-55123211 CCCCCTGAGTTGTAAGCCAGCAG No data
Right 1117376567 14:55123229-55123251 GGGCAGTGTGGGATTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117376567 Original CRISPR GGGCAGTGTGGGATTCAGTG GGG Intergenic