ID: 1117378183

View in Genome Browser
Species Human (GRCh38)
Location 14:55134851-55134873
Sequence CACACATCTCTTTTTGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117378183_1117378188 18 Left 1117378183 14:55134851-55134873 CCATGTTCAAAAAGAGATGTGTG 0: 1
1: 0
2: 0
3: 29
4: 227
Right 1117378188 14:55134892-55134914 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
1117378183_1117378189 19 Left 1117378183 14:55134851-55134873 CCATGTTCAAAAAGAGATGTGTG 0: 1
1: 0
2: 0
3: 29
4: 227
Right 1117378189 14:55134893-55134915 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1117378183_1117378187 -9 Left 1117378183 14:55134851-55134873 CCATGTTCAAAAAGAGATGTGTG 0: 1
1: 0
2: 0
3: 29
4: 227
Right 1117378187 14:55134865-55134887 AGATGTGTGGCTGGATGCGGTGG 0: 1
1: 0
2: 18
3: 163
4: 1316
1117378183_1117378192 28 Left 1117378183 14:55134851-55134873 CCATGTTCAAAAAGAGATGTGTG 0: 1
1: 0
2: 0
3: 29
4: 227
Right 1117378192 14:55134902-55134924 CCCAGCACTTTGGGATGCTGAGG 0: 743
1: 90161
2: 212207
3: 238531
4: 263715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117378183 Original CRISPR CACACATCTCTTTTTGAACA TGG (reversed) Intronic
902321159 1:15667451-15667473 CTCACATCCCTTTGTGAGCACGG + Exonic
903038889 1:20513543-20513565 AACACATTTCTTTTTTACCATGG - Intergenic
903260774 1:22130607-22130629 CACAAATTTCTTGTTGAAGAAGG + Intronic
904950590 1:34235487-34235509 CACAACTCTCTTTTTGTACTTGG - Intergenic
905707095 1:40068733-40068755 CACACGCCTCGCTTTGAACATGG - Intronic
908310435 1:62876073-62876095 CACAGATCCCTTTTTAACCAAGG - Intergenic
908856980 1:68441627-68441649 CACAAATCTCTGTTTGCAGAAGG + Intronic
909106067 1:71410629-71410651 CACATATCTCATTTTTAAAATGG + Intronic
909627693 1:77736506-77736528 CTCAGATCTCATTTTCAACAGGG + Intronic
909919136 1:81358486-81358508 CACATATCTGTTTTTGAATTGGG - Intronic
910745347 1:90568488-90568510 CCCCCTTCCCTTTTTGAACAAGG - Intergenic
911361784 1:96885642-96885664 CACATATATATTTTTTAACATGG - Intergenic
911378463 1:97081233-97081255 CAAACTTCTCTTTTTAAACATGG + Intronic
911460026 1:98177890-98177912 CTCACATTTTTTTTTAAACAAGG - Intergenic
911521104 1:98931754-98931776 CACACAAAGCTTTTTGAACCTGG - Intronic
915351737 1:155231206-155231228 CACCCACCTCTTTTTGAAGGTGG - Intergenic
916243844 1:162667003-162667025 CACACATATCATTTTCAAAATGG + Intronic
919410546 1:197236549-197236571 CTCACCTCTCTTATTCAACATGG - Intergenic
919821495 1:201475750-201475772 CACACACCTCTTTCTGGACTGGG - Intergenic
920810698 1:209282808-209282830 TACACATCTCTGTTTAAAAAGGG - Intergenic
922408447 1:225343482-225343504 CACATATCTCTTTTTGGAATTGG - Intronic
922560418 1:226565365-226565387 CAAACATCTCTGTGTGACCAGGG - Intronic
922613355 1:226945912-226945934 TAAAAATCACTTTTTGAACAGGG + Intronic
924947977 1:248858652-248858674 CACACATTTCATCTTGAATAGGG + Exonic
1066248997 10:33614869-33614891 CACACAACTCCTTCTGAAGATGG + Intergenic
1066705819 10:38176275-38176297 CCCACCTCTCTTTTAGAACAAGG - Intergenic
1066984489 10:42453326-42453348 CCCACCTCTCTTTTAGAACGAGG + Intergenic
1067370814 10:45680049-45680071 CCCACCTCTCTTTTAGAACAAGG - Intergenic
1067388963 10:45846095-45846117 CCCACCTCTCTTTTAGAACAAGG + Intronic
1067417100 10:46110852-46110874 CCCACCTCTCTTTTAGAACAAGG - Intergenic
1067445301 10:46338455-46338477 CCCACCTCCCTTTTAGAACAAGG - Intergenic
1067502516 10:46817746-46817768 CCCACCTCTCTTTTAGAACAAGG - Intergenic
1067592073 10:47522273-47522295 CCCACCTCTCTTTTAGAACAAGG + Intronic
1067639191 10:48030345-48030367 CCCACCTCTCTTTTAGAACAAGG + Intergenic
1069716294 10:70523417-70523439 CACACATGTCTTTTTGGCCCAGG + Intronic
1070136182 10:73696505-73696527 CCCACCTCTCTTTTAGAACAAGG + Intronic
1070824575 10:79383783-79383805 CACACATATTTTTTTAAAAAAGG + Exonic
1072263109 10:93701524-93701546 CACACACCTATGTTTGAAAATGG - Intronic
1072746809 10:97945909-97945931 CACAGATCTTTTTAAGAACAAGG - Intronic
1074514294 10:114150442-114150464 CACACATGTTTATTTGTACATGG - Intronic
1075908712 10:126105300-126105322 AACACATCCCTTTTTTAAAATGG + Intronic
1077929373 11:6714486-6714508 TACACATTTCATTTTAAACATGG + Intergenic
1079520857 11:21324885-21324907 CATAACTCTCTTTTTAAACAAGG - Intronic
1079549995 11:21683640-21683662 CCCAGATCTCTCTTTAAACAAGG - Intergenic
1081075238 11:38665137-38665159 GACACAGATCTTTTTGAATATGG + Intergenic
1081265379 11:41014667-41014689 TAGACAGCCCTTTTTGAACAAGG - Intronic
1081561521 11:44221436-44221458 CAGATATCTCATTTTGAACAGGG - Intronic
1081898835 11:46610312-46610334 CACACATGTATTTTTGAAACAGG - Intronic
1085819319 11:79775054-79775076 CACTCATCTCCTTTTAAAAATGG - Intergenic
1087387435 11:97489531-97489553 CCCAGATCACTTTGTGAACAAGG - Intergenic
1088286632 11:108196250-108196272 CACACATCTGATTTTGACAAAGG - Intronic
1088310937 11:108459764-108459786 CACACACCTCTTTATTTACATGG + Intronic
1089802571 11:121046781-121046803 GACACATGTGTTTTTGAACCAGG + Intronic
1090984596 11:131754782-131754804 CACTCATCTGTTGATGAACATGG - Intronic
1092026538 12:5245515-5245537 CACACATATTTTTTTTAATAGGG + Intergenic
1093349159 12:18075329-18075351 TATACATCTATTTTTGAAGATGG + Intergenic
1094424573 12:30304957-30304979 CAGAACTCTGTTTTTGAACATGG + Intergenic
1095272599 12:40237418-40237440 AACAAAACTCCTTTTGAACAAGG - Intronic
1097424106 12:59420381-59420403 AACATATCTCTTTAAGAACAGGG + Intergenic
1097659588 12:62414700-62414722 CACACTTCTATTTTTAAAAATGG - Intronic
1097753842 12:63387347-63387369 AACACCACTGTTTTTGAACATGG - Intergenic
1097757404 12:63422047-63422069 TACCAATCTCTTTTTGAAAAAGG - Intergenic
1100015447 12:90005322-90005344 CAAACCTCTCTTTCTGAAAATGG + Intergenic
1100407201 12:94281950-94281972 CATGCCTCTCTTTGTGAACATGG + Intronic
1101021089 12:100554577-100554599 CACAGACCTCTTTTTAAAAAAGG + Intronic
1101157968 12:101945572-101945594 CACACATCTGTTTTTGTTTATGG + Intronic
1101205819 12:102486301-102486323 CACACAAATCTTTGTGTACAAGG - Intergenic
1102673938 12:114643658-114643680 CAACCATCTCTTTTTGAAAATGG - Intergenic
1104778341 12:131404305-131404327 CACACTTCTCTTTGTGCAGATGG - Intergenic
1106990026 13:35407602-35407624 GACACATGTCTTTTTGATAAAGG - Intronic
1108923620 13:55708636-55708658 CACACATTTTTTTTTAAACCAGG - Intergenic
1109327779 13:60890245-60890267 CACACTTTCCTTTTTCAACAAGG - Intergenic
1109487790 13:63051055-63051077 CAAAAATCTATTTTTGTACAAGG + Intergenic
1111037231 13:82692047-82692069 CACACATCTTTTTTTAACCTTGG + Intergenic
1114777373 14:25499061-25499083 GACACATTTCTTTTTGAACCTGG + Intergenic
1116112015 14:40597087-40597109 CACACACCTTTCTTTGAAAAGGG + Intergenic
1117004206 14:51402232-51402254 CTCACATCTCTTTTAAAACCTGG - Intergenic
1117284586 14:54274819-54274841 CACAAATCTCTTATTAAAGAAGG + Intergenic
1117378183 14:55134851-55134873 CACACATCTCTTTTTGAACATGG - Intronic
1117409147 14:55434561-55434583 CACACCTCTCATTTTGGACGAGG - Intronic
1117438383 14:55739068-55739090 CACACATCTCAATTTGTACTAGG - Intergenic
1121551560 14:94806629-94806651 CTCACATCTCCTCTTGAACCAGG - Intergenic
1125447291 15:39771787-39771809 CAGAAATATGTTTTTGAACAGGG - Intronic
1129539135 15:76336865-76336887 CGCACATCTCTTTTTCTGCATGG + Exonic
1129654409 15:77514531-77514553 CACACTTCACTTTTTGAAACAGG - Intergenic
1133637875 16:7687069-7687091 CACCTATCTCTTTTTGAAAAGGG - Intronic
1135261794 16:20987349-20987371 CAGACAGGTCTTTTTCAACATGG - Exonic
1138076631 16:54049342-54049364 CAGCCATCTCTTTTTGCACAAGG - Intronic
1139034562 16:62928184-62928206 AACATATTTCTATTTGAACATGG + Intergenic
1140498174 16:75408305-75408327 CACAGATTTTTTTTTTAACATGG - Intronic
1140925041 16:79574605-79574627 CACTCTTCTCTTTTGGAAAATGG - Intergenic
1141055356 16:80808681-80808703 CACACACCTCACTTTGAAGATGG + Intergenic
1142602589 17:1061458-1061480 CAAGCATCTCCCTTTGAACAGGG - Intronic
1144759951 17:17701474-17701496 CACTCTTCTCTTTTTGCAGAGGG + Intronic
1145355016 17:22136101-22136123 CAAAAATCTATTTTTGTACAAGG - Intergenic
1148427899 17:47616121-47616143 CACCCATCTCATTTTACACATGG + Intronic
1149416793 17:56468373-56468395 CACACATTCTTTTGTGAACATGG + Intronic
1153068977 18:1082907-1082929 CACACAACACTTTTAAAACATGG - Intergenic
1153530416 18:6040635-6040657 CTCACATCTCTTTTGAGACAAGG + Intronic
1156762212 18:40606341-40606363 CACAAATCTTTTTCTGAAAATGG + Intergenic
1157175028 18:45443798-45443820 CTCAGATCTCATTTTGAATAAGG + Intronic
1157747962 18:50153328-50153350 CTGACATCTCTTGTTGCACAGGG - Intronic
1157958465 18:52125670-52125692 CAAACATTTCCTTTTGAAAAGGG + Intergenic
1158323231 18:56286392-56286414 GACATATTTCTTTCTGAACATGG + Intergenic
1158404418 18:57148127-57148149 CAGACATCTATACTTGAACATGG + Exonic
1158869802 18:61675011-61675033 CACAGATTAGTTTTTGAACAAGG - Intergenic
1160329784 18:77980713-77980735 CACCCAGGTCTTTTTGACCACGG - Intergenic
1160631717 18:80251105-80251127 CTCTCATCTTTTTTTCAACAGGG - Intergenic
1164405215 19:27938155-27938177 CCCACTTCTCTTTTAGAACAAGG - Intergenic
1165753747 19:38279068-38279090 CACACATCTTTTTGTGAGTATGG - Intronic
1167297033 19:48656934-48656956 CTCACATCTCTTTCTGACCATGG - Intergenic
1167818570 19:51905829-51905851 CACACGTCTCTGTGAGAACAGGG - Intronic
1168653336 19:58108201-58108223 CACACATAACTTATTAAACATGG - Intronic
925509258 2:4606638-4606660 CTCACACCTCTTTTTTAAAATGG - Intergenic
926833253 2:16988465-16988487 CTCACACCTCCCTTTGAACATGG + Intergenic
926836314 2:17026131-17026153 TACACATTTTTTTTGGAACATGG - Intergenic
926973782 2:18493158-18493180 CAAACTTTTCTTTTTGAACTTGG + Intergenic
930491517 2:52078760-52078782 CAAACAGCTCTTTTAGAACATGG + Intergenic
931085804 2:58829890-58829912 CACATATCTCTTTTTCTCCAGGG + Intergenic
931208905 2:60173827-60173849 GAGACATCTGTTTTTGAAAAAGG - Intergenic
931309131 2:61061984-61062006 AACACATCTATTGTAGAACATGG + Intergenic
933105353 2:78317615-78317637 CACATATCTCTATTTGGCCAGGG + Intergenic
935999299 2:108810175-108810197 CTCACCACTCTTGTTGAACATGG - Intronic
938687282 2:133751184-133751206 CACACATCTCTTTTTCAGGAAGG - Intergenic
939515628 2:143164229-143164251 CCCACATCTCTTTAGGAACATGG - Intronic
941922041 2:170861048-170861070 CTCACAACTGTTTTTGAAGAAGG + Exonic
942397868 2:175570612-175570634 CACAGATTTCTTTTTTCACAGGG + Intergenic
943381669 2:187157482-187157504 AACACATCTGTATTTGAGCAAGG + Intergenic
943406138 2:187489368-187489390 CACACACCTCTTTTTTTAAAAGG - Intronic
943562587 2:189481870-189481892 CACACATATATTTTTGGATAGGG - Intergenic
944177226 2:196845542-196845564 TTCACACCTCTTTTTGAACATGG - Intronic
944967617 2:204953602-204953624 TACACTTTTCTTTTTGAACTTGG + Intronic
945245556 2:207713223-207713245 CCCACCTCTCTTTTAGAACAAGG - Intronic
945520054 2:210815674-210815696 CACATATCTTTTTTATAACATGG + Intergenic
947388866 2:229619937-229619959 CTCACCTTTGTTTTTGAACAAGG + Intronic
948215154 2:236223013-236223035 CACACACCTTTTTTTGGAGACGG - Intronic
948227151 2:236320174-236320196 CACACATATATTTTGGACCAAGG + Intergenic
1169616491 20:7452170-7452192 CACTTATTTCTTTATGAACATGG + Intergenic
1169842585 20:9956343-9956365 CAAACATTTCTTTTTGCTCATGG + Intergenic
1170918193 20:20649126-20649148 CAGACATCTCCTGCTGAACATGG + Intronic
1172335131 20:34109752-34109774 CACACATTTATTTTTAAACCTGG - Intronic
1175849399 20:62080712-62080734 CACACATGTCATTGTGGACAGGG - Intergenic
1177874267 21:26611819-26611841 CACACATCTGGCTTTGAAGATGG - Intergenic
1181406842 22:22690850-22690872 CAGACATCTCTTCTGGAAAAGGG - Intergenic
1182898867 22:33881504-33881526 CACACTTCTCTTCTTTAAAAAGG - Intronic
1183252531 22:36740296-36740318 CACAAATCTCTTTTTCACCTTGG + Intergenic
1185115597 22:48934237-48934259 AACATATCTCTGTTTGAAGATGG - Intergenic
951662994 3:25091281-25091303 TACACATCTCTTTATGACAAAGG + Intergenic
952608189 3:35174509-35174531 TACACATCACTTATTGAAAAGGG + Intergenic
955463070 3:59206675-59206697 AACACATTTCTTTTTGTAAAAGG - Intergenic
955645884 3:61136894-61136916 AACACACCTGTTTTTGCACATGG - Intronic
958714850 3:97767397-97767419 CACAAATCCCTTTGTGAAGAAGG - Intronic
958829689 3:99072418-99072440 CACACACCTCTATTTTACCAGGG + Intergenic
960006414 3:112785757-112785779 CACACAGCTGTTTTTGTATATGG - Intronic
960124002 3:113977983-113978005 CCCACTTCTCTTTTTAAAGATGG + Intronic
960391770 3:117085516-117085538 CAGACTTCTCTTTTTAAGCAAGG + Intronic
961176616 3:124840965-124840987 CACACAATTCTTTTTCAACTGGG + Intronic
961979317 3:131060155-131060177 CATACATCTGTCTTTTAACAGGG - Intronic
964164394 3:153684705-153684727 CATACATCTTCTTATGAACAAGG + Intergenic
964256272 3:154778036-154778058 CTCATATCTCTTTTTGAATGCGG + Intergenic
964275675 3:155006373-155006395 CACACTTGTCTTTTTTAAAAAGG + Intergenic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
967295401 3:187959309-187959331 CAGGCATCACTTCTTGAACATGG - Intergenic
967518688 3:190402258-190402280 CCAACTTCTCTTTTTGATCAAGG + Intronic
967966053 3:194960978-194961000 CAAACAGCTCTTTTGGAGCATGG + Intergenic
969252107 4:5974697-5974719 AACACATTTCATCTTGAACATGG - Intronic
972262131 4:37419820-37419842 CAAACATCTCTTATAGAATAAGG + Intronic
972381449 4:38523885-38523907 TCCAGATCTCTGTTTGAACAAGG + Intergenic
974396557 4:61343462-61343484 CACACATCACTTTTGATACAGGG - Intronic
975543929 4:75542413-75542435 CAAACATTTCCTCTTGAACATGG - Intronic
976266812 4:83192913-83192935 CACACATCCATTTTTTAAAAGGG - Intergenic
976622397 4:87142514-87142536 CAAACTTACCTTTTTGAACATGG + Intergenic
982331853 4:154189740-154189762 GTCAAATCTGTTTTTGAACATGG + Intergenic
985037525 4:185856260-185856282 CACACAGCTCTATGTGACCAGGG + Intronic
988666605 5:33335719-33335741 TACTGATCTCTTTTTTAACATGG - Intergenic
989119915 5:37994293-37994315 CACACATCACTCTCTGAATAAGG - Intergenic
990028416 5:51224646-51224668 CACATATCCTTTTTTGAAAATGG + Intergenic
991285357 5:64969116-64969138 CACACGCATCTTCTTGAACACGG - Intronic
993352317 5:86865814-86865836 CAAAAATATCTTTTTGTACATGG - Intergenic
993827378 5:92708481-92708503 AACACATCTCTTTCTGTAGAAGG - Intergenic
994843913 5:104960564-104960586 TACACATTTCTTTTTTTACAAGG - Intergenic
995762323 5:115576571-115576593 CACACATCTCTTGCTGATCAAGG + Intergenic
996919768 5:128754196-128754218 CACAGATATCTTTTTTGACAGGG - Intronic
997721590 5:136082265-136082287 CACACGCCTTTTTGTGAACATGG + Intergenic
998751070 5:145321936-145321958 CACACATCTCCTGTTGAGGATGG - Intergenic
1000881856 5:166706963-166706985 TACACAGCTCATTTGGAACAAGG - Intergenic
1001093985 5:168762109-168762131 AACACATCCCTTTATTAACATGG + Intronic
1001121678 5:168985949-168985971 CAATCATCTCTTTTTAAACTTGG + Intronic
1001223780 5:169926486-169926508 CACAAAGCTTTCTTTGAACATGG - Intronic
1002332910 5:178457067-178457089 CCCACACCTTTTTTGGAACAAGG - Intronic
1002680085 5:180954899-180954921 CACACGTCTCTGTATGAACTTGG - Intergenic
1003809483 6:9763986-9764008 TACACATTTCTTTTTAAACCAGG - Intronic
1005179318 6:23086065-23086087 AATACATCTGTTTTTGAAAATGG - Intergenic
1005260665 6:24055972-24055994 CACTCATCTCTACATGAACAAGG + Intergenic
1006715629 6:36118027-36118049 CACGTATCTCTTCTTAAACAAGG - Intergenic
1010525570 6:76896107-76896129 CACTAATCTGTTTTTGCACAAGG - Intergenic
1011006873 6:82655354-82655376 CACTCAACTCCTTATGAACAGGG + Intergenic
1011844367 6:91544843-91544865 CAGATATCATTTTTTGAACAGGG - Intergenic
1013329893 6:109089894-109089916 CACACATCCACTTTTGACCATGG + Intronic
1014782352 6:125578850-125578872 CACACAGATCTTCTTCAACAAGG - Intergenic
1014795898 6:125724010-125724032 CACAAAACTCTTTATGGACAGGG + Intergenic
1016254056 6:142082627-142082649 CACACAACTCTCTTAAAACATGG - Intronic
1017681030 6:156863876-156863898 CACACATCCAATTTTGCACATGG - Intronic
1018131164 6:160733457-160733479 CTCATAGCTCCTTTTGAACAGGG + Intronic
1018867460 6:167757417-167757439 CACAGATGTCATTTTGCACATGG + Intergenic
1018919896 6:168164882-168164904 CAAACATCTCGTCTTTAACAAGG - Intergenic
1019130890 6:169873558-169873580 CACAAATTTTTTTTTGAAAAAGG - Intergenic
1021140870 7:17023156-17023178 CACAAATCTCTTTATGATCATGG - Intergenic
1021264978 7:18509036-18509058 GACACATCTATTTTTTAAAAAGG + Intronic
1021768271 7:23970735-23970757 CCCCCACCCCTTTTTGAACAGGG + Intergenic
1022155671 7:27660216-27660238 CACACATTACTATCTGAACATGG + Intronic
1022650387 7:32268504-32268526 CTTAAATCTCTTTTGGAACAAGG - Intronic
1023084825 7:36559966-36559988 CCCACATCATTTATTGAACAGGG + Intronic
1024664005 7:51528068-51528090 GAACCATCTCTTTTTGTACAGGG + Intergenic
1024701731 7:51910859-51910881 CAATCATCTCTTTGAGAACAAGG - Intergenic
1028012842 7:85671072-85671094 CAGACATGTCTTTCTGAAAAAGG - Intergenic
1032089112 7:128902372-128902394 GGCACATCTCATTTTGAACCTGG + Intronic
1033271302 7:139935328-139935350 TACACATCACTTTATGTACATGG + Intronic
1034295584 7:149969253-149969275 CACACAGCTCTTTCTGAGGATGG - Intergenic
1034940660 7:155228268-155228290 CACACATCTCTGTCTGGACAAGG + Intergenic
1035678667 8:1471658-1471680 CACACCTCCCTTTATGAGCATGG + Intergenic
1036604042 8:10290717-10290739 CACAGACCTCTTTTTAAACTTGG + Intronic
1037419141 8:18683511-18683533 CAGTCATCTCATTTTGAGCACGG + Intronic
1042414781 8:68506823-68506845 ACCACATCTCTTTTTTAATATGG + Intronic
1043121246 8:76327747-76327769 CATACATATCTTTTTGACTATGG + Intergenic
1043290853 8:78598549-78598571 CACACATTTCTCTATGAGCATGG + Intronic
1045879666 8:107023370-107023392 CAGACATCTCTTTTTAAAGCAGG + Intergenic
1046623334 8:116551067-116551089 CACACATTTATTTTTAAAAAGGG - Intergenic
1048062862 8:130938373-130938395 CACATATCTGTTTTTCATCATGG + Intronic
1049771017 8:144381584-144381606 CACACATCTGTTTCTGCACCCGG - Intronic
1049771044 8:144381746-144381768 CACACATCTGTTTCTGCACCCGG - Intronic
1050021339 9:1287411-1287433 CAAAACTCTCTTTTTGAGCATGG + Intergenic
1051134949 9:13909754-13909776 CACACATATCTTTTCAAAAAGGG + Intergenic
1051816559 9:21114047-21114069 CACCCCTCTGTTTTTCAACACGG - Intergenic
1053604852 9:39647263-39647285 AACACTTCTCTTTTTGAAAAAGG + Intergenic
1053862727 9:42403613-42403635 AACACTTCTCTTTTTGAAAAAGG + Intergenic
1054248689 9:62695152-62695174 AACACTTCTCTTTTTGAAAAAGG - Intergenic
1054562802 9:66729678-66729700 AACACTTCTCTTTTTGAAAAAGG - Intergenic
1055065208 9:72111742-72111764 CACACATATCTTTGTTAGCAGGG + Intergenic
1055450864 9:76430386-76430408 CACTCATTTTTTTTTTAACAGGG + Intronic
1055543731 9:77344406-77344428 CAAACATTTCTTTTTGTAGAAGG + Intronic
1057335502 9:94151935-94151957 AACACATCTAGTTTTGTACAAGG - Intergenic
1059529090 9:115019202-115019224 AACATTTCTCTTTTTAAACAAGG - Intergenic
1059668094 9:116468230-116468252 CTCTCATCTCTTTCTGAAAAAGG - Intronic
1060902050 9:127267561-127267583 CACACATGTCATTTTTAATACGG - Intronic
1060976260 9:127766957-127766979 CACCCAGCTCTTTTTGCCCAGGG - Intronic
1187369279 X:18690952-18690974 CACACAGGTCTTATTGAAGAGGG - Exonic
1188215276 X:27468849-27468871 CATACATCTCTCTTTGCCCAGGG - Intergenic
1189773283 X:44446968-44446990 CACACAGCTATTTGTGAATATGG + Intergenic
1193883527 X:86956837-86956859 CAACCATCTCATTTTCAACAAGG - Intergenic
1195563722 X:106316925-106316947 TAAACATCTCTTTATGATCATGG - Intergenic
1197612444 X:128654365-128654387 CACCCAGCCCTTTTTGAACGGGG - Intergenic
1200806220 Y:7436261-7436283 CCCACATCTTTTTTTGAAGCAGG + Intergenic
1201250705 Y:12054678-12054700 AATACATTTCTTTTTGAACATGG + Intergenic
1201254206 Y:12091139-12091161 CCCACACCTCTCCTTGAACAAGG - Intergenic
1201629022 Y:16048696-16048718 TAATCACCTCTTTTTGAACATGG - Intergenic
1201652377 Y:16303992-16304014 CTCACATCTCTAGTAGAACAGGG + Intergenic