ID: 1117378473

View in Genome Browser
Species Human (GRCh38)
Location 14:55137105-55137127
Sequence TAGTGGGGACAGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 1, 3: 75, 4: 593}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117378467_1117378473 -1 Left 1117378467 14:55137083-55137105 CCAGAGTAGGGGATGGGGCAGTT 0: 1
1: 0
2: 1
3: 18
4: 200
Right 1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG 0: 1
1: 0
2: 1
3: 75
4: 593
1117378466_1117378473 0 Left 1117378466 14:55137082-55137104 CCCAGAGTAGGGGATGGGGCAGT 0: 1
1: 0
2: 2
3: 40
4: 269
Right 1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG 0: 1
1: 0
2: 1
3: 75
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117378473 Original CRISPR TAGTGGGGACAGAGGGCAGA TGG Intronic
900946477 1:5833978-5834000 CAGAGGGGACACTGGGCAGAAGG + Intergenic
901565537 1:10111391-10111413 TAGTGGGGAGAGTGGTCCGAAGG - Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901862590 1:12084396-12084418 TGGTGGGGACAGAGGGAGTATGG + Intronic
902086818 1:13869016-13869038 TCGTGGGGACAGCGGGAGGAGGG + Intergenic
902607395 1:17576230-17576252 TAGTGGGGCCTCTGGGCAGATGG + Intronic
902779191 1:18693578-18693600 GAGTGAGGACAGGGGGCGGAGGG - Intronic
903018898 1:20379891-20379913 GGGTGGGGAAAGAGGGCAGGTGG - Intergenic
903217265 1:21850191-21850213 TGCTGGGGACAGAGGGCAAAGGG + Exonic
903261946 1:22136315-22136337 TTGTGGGGACACAGGTCGGATGG - Intronic
903442887 1:23401647-23401669 TAGTGGGGGAAGAGGACACAGGG - Intronic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
903603348 1:24557626-24557648 AAGTGGGGAGAGGGGACAGAAGG + Intronic
903983477 1:27206889-27206911 TAGGTGGGACAGAAGGCAGACGG - Intergenic
904002909 1:27348995-27349017 TATTGGGGTCAGAGGTCATAGGG - Intronic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904600245 1:31668928-31668950 GAGTGGGAACAGAAGGCAGTGGG - Intronic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904978887 1:34479994-34480016 TAGTGCAGGCAGAGGGGAGAAGG + Intergenic
905085240 1:35368191-35368213 TAGTTGGGACAGAGACCATATGG + Intronic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
905867671 1:41385057-41385079 TAGTGGGGTCAGAGCCCAGAAGG + Intergenic
906196392 1:43933137-43933159 AAGTGGGTACTGAGGGCTGAAGG - Intergenic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
906997689 1:50815226-50815248 TAGAGGGGAGAGAGGGGAGGTGG - Intronic
907193143 1:52665386-52665408 GGGTGGGGACAGAGGTCAGCAGG + Intronic
907438005 1:54461938-54461960 GAGTGGGGGCTGGGGGCAGAGGG + Intergenic
907823982 1:57997687-57997709 AAGTGGGGTCTGAGGGGAGAAGG + Intronic
907937942 1:59059240-59059262 TAGTGGTGACAGGTGACAGATGG + Intergenic
908234593 1:62137565-62137587 GAGGGGGGACAGAGGCCTGAGGG + Intronic
908234613 1:62137619-62137641 GAGGGGGGACAGAGGCCTGAGGG + Intronic
908272708 1:62436665-62436687 GAGACGGGACAGAGAGCAGACGG - Exonic
908381854 1:63604441-63604463 TAGTGGGCACAGGGGAGAGATGG + Intronic
908693355 1:66807928-66807950 TAGAGGGGATAGAGAGCAGTGGG - Intergenic
908979803 1:69942117-69942139 GAGTGGGCACAGTGGGCAGTAGG + Intronic
909007907 1:70298845-70298867 TAGTTGTGACAGAGGCCATATGG + Intronic
909218798 1:72927600-72927622 TATTGAGAACAGAGGGCAAAGGG - Intergenic
910352082 1:86309343-86309365 TAGAAGGGAGAGAGGGTAGATGG - Intergenic
911110470 1:94178742-94178764 TAGTGGGTACTGAAGGAAGATGG + Intronic
912449577 1:109760838-109760860 TGGTGGGGAGAGCAGGCAGAGGG - Intronic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
914860532 1:151382123-151382145 TAGGGTGGACTGAGGGGAGAGGG - Intergenic
914920613 1:151844838-151844860 TAGTGGGGAAAGAGGTCTGGAGG - Intergenic
915334116 1:155130498-155130520 GAGAGGGGAGAGAGGGGAGAGGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915934067 1:160080320-160080342 GTGTGGGGACAGGGGGCATACGG + Intergenic
916242873 1:162657542-162657564 TAATGGGTACTGAGAGCAGAAGG + Intronic
916403606 1:164475111-164475133 TGGTGATGACAGTGGGCAGAGGG + Intergenic
919204423 1:194403123-194403145 TCTTGGAGACAGAGAGCAGAAGG + Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
920920625 1:210294697-210294719 GAGTGGAGATAGAGGGCTGATGG - Intergenic
920961984 1:210671590-210671612 TTGAGAGGACAGAGGGAAGAAGG + Intronic
921258656 1:213365816-213365838 TAGTTAGGACAGAGTGCATATGG - Intergenic
921339642 1:214121980-214122002 TAGTGGGGAAAGCTGGCTGAAGG + Intergenic
921382484 1:214538745-214538767 TGGGGGAGACAGAGGGCAGAAGG + Intronic
921563405 1:216686203-216686225 TAGTGGGGAGACAGGGAGGAGGG + Intronic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922109225 1:222541261-222541283 TACTGGGTGCAAAGGGCAGAAGG + Intronic
922194875 1:223351366-223351388 GAGTGGGGACTGAGGGCACCTGG - Intronic
922598445 1:226832086-226832108 AAGTTGGGACAGAAGGAAGATGG + Intergenic
922997587 1:229977000-229977022 TGGTGGTGACAGAGGGAAGTAGG + Intergenic
924439833 1:244077004-244077026 GAGTAGCGACAGATGGCAGAAGG - Intergenic
1062893202 10:1081516-1081538 AAGTGAGGACAAACGGCAGAAGG - Intronic
1063122559 10:3115029-3115051 TGGAGGGCACGGAGGGCAGATGG + Intronic
1063814933 10:9760593-9760615 TAGTGGGAGCAAGGGGCAGAGGG + Intergenic
1064213542 10:13380973-13380995 TGGTGGGGGCAGAAGGCAGGAGG + Intergenic
1065045855 10:21747185-21747207 GAGTGTGGACAGTTGGCAGAGGG + Intergenic
1065163796 10:22953136-22953158 TGGTGGACACAGAGGTCAGAAGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1067156415 10:43784739-43784761 TTCTGAGGACAGAGTGCAGATGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067720925 10:48727221-48727243 AATTAGGGACAGAGGGCTGAGGG + Intronic
1067790497 10:49283996-49284018 TTATGGGGACACAGGGCAGTGGG + Intergenic
1068890925 10:62147713-62147735 TACTGGGGACAAATGCCAGAGGG - Intergenic
1069920211 10:71811768-71811790 TAGTGGGGACACAGGTGAGAAGG + Intronic
1070222681 10:74466395-74466417 AAGTAGGGACTGAAGGCAGAGGG - Intronic
1070490730 10:76973949-76973971 CACTGGGGAAACAGGGCAGAGGG - Intronic
1070685299 10:78476052-78476074 TAGTCCCGGCAGAGGGCAGAGGG - Intergenic
1070840550 10:79484457-79484479 TATTTGGGACAGAGTACAGAGGG + Intergenic
1071071849 10:81703744-81703766 TACTGGGGACAGAGCGCTTATGG + Intergenic
1071417631 10:85455975-85455997 TAGAGGACACTGAGGGCAGATGG + Intergenic
1071863812 10:89703454-89703476 TAGAGGGGAAAGAGGGCAAGGGG + Intronic
1072169752 10:92848277-92848299 TAGTCGCGAGAGAGGGCAGGAGG + Intronic
1072456251 10:95578945-95578967 GGGTGGGGACAGTGGGCAGTGGG + Intergenic
1072559705 10:96560144-96560166 TAGGTGGGAAAGAAGGCAGACGG - Intronic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1074063248 10:109988045-109988067 TAGTACAGACAGAGGGGAGATGG - Intergenic
1074267192 10:111916257-111916279 TAGTTGTGACAGAGGCCATATGG + Intergenic
1074410626 10:113225487-113225509 GGGTGGGGACAGAAGGCACAGGG + Intergenic
1074827548 10:117225286-117225308 CAGTGGGGAGAGAAGGCTGAGGG - Intergenic
1075017109 10:118917951-118917973 GAGAGGGGACAGAGGGAACAGGG + Intergenic
1075147634 10:119895824-119895846 TACTGGGGGCAGAGGACACAGGG - Intronic
1075153623 10:119956338-119956360 GACTGGAGACAGAGGGAAGAAGG + Intergenic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1075798225 10:125135878-125135900 GAGCAGGGTCAGAGGGCAGAAGG - Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076704414 10:132293467-132293489 TCATGGGGACACAGGGCAGGCGG + Intronic
1077017764 11:404463-404485 CAGGAGGGACAGCGGGCAGAGGG + Intronic
1077524077 11:3053846-3053868 TAGCAGGGTCAGAGGGCAAAGGG - Intronic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079436534 11:20459034-20459056 TAGTTGGGACAGAGGCTATATGG - Intronic
1079506253 11:21155670-21155692 GAGAGGGGACAGAAGTCAGAGGG + Intronic
1079515700 11:21265887-21265909 AATTGGGGTCAGAGGGTAGAGGG - Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079748517 11:24164079-24164101 GAGTGGGGCCAGATTGCAGAGGG - Intergenic
1079975281 11:27083480-27083502 TAGGAGGGACAGTGGGAAGATGG - Intronic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1080547525 11:33335686-33335708 TGGTGGGGAGAGAGCTCAGAGGG + Intronic
1080553590 11:33395868-33395890 TACTCAGCACAGAGGGCAGAAGG + Intergenic
1080895523 11:36446276-36446298 TAGAGGGGACAGAGGAGAGAGGG - Intronic
1081546726 11:44077203-44077225 GACTGGGGACAGTGGACAGAGGG + Intronic
1081677467 11:44979309-44979331 TTGAGAGGGCAGAGGGCAGAAGG + Intergenic
1081682692 11:45019343-45019365 TGGTGGGGACAGGCGGCAGGGGG + Intergenic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083150442 11:60788711-60788733 TAGTGGGGTGAGTGGGCAGAGGG - Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1084947975 11:72649138-72649160 TGGTGGGGAGAGTGGCCAGAAGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085460593 11:76690675-76690697 TCTAGGGGACAGAGGACAGAGGG + Intergenic
1085779924 11:79398839-79398861 TAGAGTGGACCTAGGGCAGATGG + Intronic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086458407 11:86982027-86982049 TAGTGGTAACAGAGGCCACACGG - Intergenic
1086831615 11:91572730-91572752 AAGTGGGCACAGGGTGCAGATGG + Intergenic
1087076802 11:94133263-94133285 TGTTGGGGACAGAGAGCAGAAGG + Intronic
1087302166 11:96448313-96448335 TAATGGGGAAAGAAGCCAGAAGG - Intronic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1088363518 11:109016243-109016265 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088363563 11:109016415-109016437 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088363599 11:109016547-109016569 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1089113405 11:116074625-116074647 TGGAGGGGGCAGAGGGCAAATGG - Intergenic
1089311648 11:117562000-117562022 GAGTGGGGACAGTGGGAAGCAGG + Intronic
1089684262 11:120137061-120137083 TAGGGGGGACAGGGGGCATGAGG + Intronic
1090171963 11:124613192-124613214 TGGTGGGGATAGAGGCAAGAGGG - Intronic
1090987005 11:131776789-131776811 TAGTGGAGTCACAGGACAGAAGG - Intronic
1091364709 11:135007961-135007983 TGGGGCGGAAAGAGGGCAGAGGG + Intergenic
1091497114 12:982196-982218 TAAAGGGGACACAGGACAGAAGG - Intronic
1092677096 12:10932107-10932129 TAGAAGGGATAGAGGGCAAAAGG + Intronic
1092975974 12:13745296-13745318 TGGTGGGAAGAGAGAGCAGATGG + Intronic
1093809932 12:23479639-23479661 TAATGGAGACAGAGAGTAGAAGG + Intergenic
1095178271 12:39118017-39118039 TAGAGGAGGCAGAAGGCAGAAGG - Intergenic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1096176548 12:49524502-49524524 AAGTGGAGGAAGAGGGCAGAAGG + Intronic
1096357412 12:50952866-50952888 TTGAGGGGAAAGAGGGCACAGGG - Intergenic
1096473888 12:51896311-51896333 TAGGGAGGACAGAGGACAGATGG + Intergenic
1097224291 12:57467959-57467981 GAGTGGAGACAGAAGGCAAACGG - Intronic
1097291840 12:57923191-57923213 GTGTGGGGACAGGAGGCAGATGG + Intergenic
1097335853 12:58382595-58382617 TAGTAGGGACAGAGTCCTGATGG - Intergenic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1098212218 12:68178724-68178746 TGTAGGGGACAGAGGGCATACGG + Intergenic
1098499089 12:71169563-71169585 TAGTGGAGACAGAGCCCAAATGG + Intronic
1098961824 12:76746747-76746769 GAGTGGGCACAGAGAACAGATGG + Intergenic
1098962094 12:76749269-76749291 TAGTTGGAACAGAGGCCATATGG - Intergenic
1100300042 12:93298486-93298508 TCGTGGAGACAGAGAGTAGAAGG + Intergenic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1100978052 12:100142697-100142719 TAGCCGGGACAGAGAGGAGACGG - Exonic
1101012731 12:100467670-100467692 CAGTGGGGACAGAGGCCAGTTGG + Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1102124518 12:110469171-110469193 TGTTGTGGACAGAGGGCAGAGGG + Intronic
1102149224 12:110677295-110677317 GAGTGGGGACAGAGGTGAGAGGG - Intronic
1102569401 12:113818381-113818403 TACTGGGGCCAGTGGGCAGGGGG + Intronic
1102650694 12:114440128-114440150 CAGCGGGGACAAAGGCCAGAGGG - Intergenic
1102683202 12:114704354-114704376 AAGTGGGGGCAGTGGGCAGCAGG + Intergenic
1103618640 12:122171949-122171971 GAGTTGTGGCAGAGGGCAGATGG - Intronic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1104174088 12:126312249-126312271 TAATGGCTACAGAGGGCAAAGGG + Intergenic
1104305539 12:127607586-127607608 TAGTGGTGATAGAGGCCAGAGGG + Intergenic
1104864481 12:131944732-131944754 GGGTTGGGGCAGAGGGCAGAAGG + Exonic
1106353473 13:28956765-28956787 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353487 13:28956825-28956847 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353497 13:28956885-28956907 TGATGGCGACAGAGGGAAGAAGG + Intronic
1106471617 13:30060968-30060990 GGCTGGGGACAGAGGACAGAGGG + Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1107094958 13:36526406-36526428 TGGTGGTGACAGAGTGCAAATGG - Intergenic
1107126889 13:36856035-36856057 TGGTGGTGCCAGGGGGCAGAAGG + Intronic
1107387283 13:39925928-39925950 TAGTGGGGATAGAGGCCACCAGG + Intergenic
1107550099 13:41465896-41465918 TAGGAGGCTCAGAGGGCAGAAGG + Intronic
1108026089 13:46179556-46179578 TAGTGGGGGCAGGGAGAAGATGG + Intronic
1110184333 13:72655883-72655905 TAGGTGGGACAGAGAACAGAAGG + Intergenic
1110735265 13:78928766-78928788 GACAGGGGACAGAGGGCAGGGGG - Intergenic
1112290047 13:98138299-98138321 TGGTGGTGACAGAAGCCAGATGG - Intergenic
1112668751 13:101610687-101610709 TAGTGGCCACAGAGAGCACAGGG + Intronic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1115901455 14:38154105-38154127 TATTTGGGAAAGAGGGTAGAAGG + Intergenic
1116195657 14:41722588-41722610 GAGTGGGGACAAAGGGAAAAGGG - Intronic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116469624 14:45271983-45272005 GTGTGGGGACAGGGGGCATATGG - Intergenic
1116742541 14:48775500-48775522 TAGTCGTGACAGAAGGCAAAGGG - Intergenic
1117033813 14:51705719-51705741 TGATGGGGAAAGAAGGCAGATGG - Intronic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117446105 14:55805129-55805151 TGTTGGGGACTGTGGGCAGAGGG + Intergenic
1118436281 14:65773615-65773637 AAGAGGTGACAGAGGGTAGATGG - Intergenic
1118765468 14:68906692-68906714 GAATAGGGACAGAGGGCTGAGGG - Intronic
1118796940 14:69152665-69152687 GGGTGGGGACAGAGGGCAGGAGG + Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1119483865 14:74975889-74975911 AAGGGGGCACAGAGGGGAGATGG - Intergenic
1119787269 14:77322876-77322898 TAGGGGTGGCAGAGGGGAGAGGG + Intronic
1120056642 14:79932055-79932077 TAGTGGGCTCAGAGGGCAGGGGG - Intergenic
1121115955 14:91342867-91342889 TAGTTGTGACAGAGGCCAAATGG - Intronic
1121465916 14:94115568-94115590 TAGTGGGGTCACTGGGCACAGGG - Intronic
1121469226 14:94138994-94139016 GAGAGGGGGCAGAGGGCAAAGGG - Intergenic
1121518219 14:94568008-94568030 TTGTGGGGACAGAACTCAGATGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122028728 14:98896975-98896997 GACTGGGGACAGAGGGGAGTGGG - Intergenic
1122170891 14:99874300-99874322 GTGTGCGGACAGAGAGCAGAAGG + Intronic
1122449919 14:101797473-101797495 GGGTGGAGAAAGAGGGCAGAGGG - Intronic
1122530136 14:102419488-102419510 TGGTGGGGACAGAGTGCAGGCGG + Intronic
1122654991 14:103252416-103252438 TCGTGGAGACAGAGAGTAGAAGG + Intergenic
1122696787 14:103558167-103558189 CGGTGGGGTCAGAGGGCAGTCGG - Intronic
1122723075 14:103732844-103732866 TTGTGGGGATAGGGGGCAAATGG - Intronic
1122979414 14:105184948-105184970 TAGCGGGGCCAGAGGGCATGTGG + Intergenic
1123469517 15:20539729-20539751 TCCTGGGGACAGAGGGCCCAAGG - Intronic
1123648545 15:22460970-22460992 TCCTGGGGACAGAGGGCCCAAGG + Intronic
1123729795 15:23134715-23134737 TCCTGGGGACAGAGGGCCCAAGG - Intronic
1123747963 15:23332197-23332219 TCCTGGGGACAGAGGGCCCAAGG - Intergenic
1124280330 15:28356049-28356071 TCCTGGGGACAGAGGGCCCAAGG - Intergenic
1124302368 15:28555563-28555585 TCCTGGGGACAGAGGGCCCAAGG + Intergenic
1124437495 15:29663060-29663082 TAGTGGGTACAGAGCTCAGCTGG - Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125762740 15:42108390-42108412 GAGTGGGGAAAGAGGTCTGAAGG - Intergenic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126599540 15:50415142-50415164 AAATGGTGACAGAGGGAAGAGGG - Intergenic
1127672756 15:61211666-61211688 TGATGGCCACAGAGGGCAGAGGG + Intronic
1127817653 15:62625836-62625858 GAGTGGGCAGAGTGGGCAGATGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1129712362 15:77826785-77826807 GAATGGGGAGAGGGGGCAGATGG - Intergenic
1129773602 15:78218483-78218505 CAGTGGGGACACAGAGCAGAAGG + Intronic
1130096590 15:80860801-80860823 TGGTGAGGTCAGAGGGCAGAGGG - Intronic
1130220176 15:82012873-82012895 TAGGGCTGACAGAGGGCACAGGG - Intergenic
1130547800 15:84869263-84869285 AAGTGGGGTGAGAGGCCAGAGGG - Exonic
1131079600 15:89523535-89523557 TATTGGGGACAGAGGAGTGAAGG - Intergenic
1131135347 15:89930337-89930359 TAGCAGGGTCAGAGGGCACAAGG - Intergenic
1131333709 15:91526615-91526637 GAGAGGAGACAGAGGGCTGAGGG - Intergenic
1132478202 16:153056-153078 GAGTGGGGACAGTGGGGAGGGGG + Intronic
1132480151 16:163268-163290 GAGTGGGGACAGTGGGGAGCGGG + Intronic
1132747410 16:1442777-1442799 TACTGGGGACACACGGCAGGGGG + Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132853733 16:2035750-2035772 TAGTGTGGACAGGGCACAGAGGG - Intronic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1133610922 16:7432571-7432593 TAGTTGTGACAGAGACCAGATGG - Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1135222777 16:20627247-20627269 CACTGGGGACAGAGGTAAGATGG - Exonic
1135241915 16:20814844-20814866 TAGAGGGGAAATAGGGGAGAAGG - Intronic
1135869808 16:26138843-26138865 TCCTGGAGAAAGAGGGCAGAGGG + Intergenic
1136911336 16:34146974-34146996 AAGCGGGGACAGGGGGGAGAGGG - Intergenic
1137589624 16:49685677-49685699 CAGTGGGGACCGAGAACAGAGGG - Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138182135 16:54948595-54948617 GAGTGGGGTCAGATGGAAGAAGG - Intergenic
1138306671 16:55983170-55983192 TTGTGGGGGCAGAGGGTATATGG - Intergenic
1138488726 16:57363754-57363776 TAGAGGGGTCAGGGGGGAGATGG - Exonic
1138510551 16:57506271-57506293 GAGAGGGGACTGAGGGCAGGGGG + Intergenic
1139372302 16:66476650-66476672 TGGTTGGGCCAGAGGGCAGCTGG - Intronic
1139377433 16:66508982-66509004 ACGTGGGGGCAGAGGGGAGAGGG + Exonic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140477661 16:75247086-75247108 AGGTGGGGGCAGAGGGGAGAAGG - Intronic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1141183694 16:81772200-81772222 TATTTGAGACAGAGAGCAGAGGG + Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141662862 16:85450890-85450912 TAGTAGAGACAGGGGGCAGGGGG - Intergenic
1141838978 16:86562162-86562184 AGGTGGGGTCAGAGGGGAGAAGG - Intergenic
1141955292 16:87366749-87366771 GAGGGGAGGCAGAGGGCAGACGG + Intronic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142819146 17:2450445-2450467 GAGTGTGGACAGACTGCAGAGGG + Intronic
1143016884 17:3895535-3895557 TGGTTGGGGAAGAGGGCAGAAGG + Intergenic
1143595132 17:7909452-7909474 GAGTGGGGTTAGAGGTCAGAGGG - Intronic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145827540 17:27888373-27888395 TGGTGGGGCCTGAGGGCAGGTGG - Intronic
1146624032 17:34422522-34422544 TCCTGGGGACAGAGGGATGAGGG - Intergenic
1147169237 17:38608538-38608560 AAGTGGAGCCAGAGGACAGATGG + Intergenic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1147588187 17:41665186-41665208 TGGGGGGGACAGTGGGGAGAGGG - Intergenic
1148769325 17:50057704-50057726 CAGTGGGGTCAGAGGCCAGGTGG - Intronic
1148830878 17:50430159-50430181 TGGTGGGGACAGAGGGGTAAGGG + Intronic
1148891937 17:50814224-50814246 TGCTGGAGCCAGAGGGCAGAGGG + Intergenic
1149374435 17:56030234-56030256 TAGTTGTGACAGAGACCAGATGG + Intergenic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150645038 17:66972557-66972579 TTGCAGGGACAAAGGGCAGAGGG + Intronic
1151361584 17:73592520-73592542 TGGTGGGGACAGATGGCTGGAGG - Intronic
1151418293 17:73981118-73981140 TAATGGGGACAGAGGACAACAGG + Intergenic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1152471133 17:80490659-80490681 TAGAAGGGAGAGAGGCCAGAAGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152807603 17:82363879-82363901 TGGTGGGAACAGAGGATAGAAGG + Intergenic
1152882114 17:82823581-82823603 TGGTGGGGGCAGACGGCAGTGGG + Intronic
1153398916 18:4660047-4660069 TAGAAAGGACAGAGGCCAGAAGG + Intergenic
1153666268 18:7369911-7369933 GTGTGGGGACAGAGGGCATGAGG + Intergenic
1155949539 18:31895413-31895435 TGGTGGGGAGAGGGGGCAGGTGG - Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158307814 18:56125763-56125785 TAGCTGGGACATAGGGCACATGG + Intergenic
1158581896 18:58691163-58691185 TAGTGGGGAGAGGGGACAGAAGG - Intronic
1158618906 18:59013215-59013237 TAGGGAAGAAAGAGGGCAGAAGG - Intergenic
1158890371 18:61866598-61866620 TGATGGAGATAGAGGGCAGATGG - Intronic
1159477958 18:68948692-68948714 TAGTGGGGAAATGGGACAGAAGG - Intronic
1159573862 18:70152080-70152102 AAGTGGAGACAGAGGTTAGAAGG - Intronic
1160907473 19:1458232-1458254 TCATGGGGACAGAGGGCCCAGGG - Intronic
1161008257 19:1947384-1947406 TCCTGGGGACAGAGGTCAGATGG - Intronic
1161093872 19:2377548-2377570 GAGAGGGGAGAGAGGGGAGAGGG - Intergenic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161398722 19:4058498-4058520 GGGTGGGGACAGGGGCCAGAGGG - Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162186461 19:8908930-8908952 TGGTGGGCACAGAGGTCCGATGG + Exonic
1162325230 19:9995446-9995468 TAGTGGGAAAAGAGTGCTGAAGG - Intronic
1162531453 19:11238473-11238495 GAGATAGGACAGAGGGCAGAGGG + Intronic
1162637550 19:11981909-11981931 TAGAGTGGAAAGAGGGCAGCAGG + Intergenic
1163860251 19:19739039-19739061 GAGTAGGGGCAGAGGGCTGAAGG - Intergenic
1164429874 19:28177825-28177847 AAGTGGTGACAGAGGGCACCTGG + Intergenic
1165332869 19:35151047-35151069 TAGAGGGTACAGAGGGCAAGGGG + Intronic
1165427226 19:35752915-35752937 TGGTGGGGGAAGCGGGCAGATGG - Exonic
1165449661 19:35874672-35874694 CCGTGGGGGCAGAGAGCAGAGGG + Intronic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165785127 19:38457210-38457232 TAGTGAGGTAAGAGGTCAGAAGG - Intronic
1166110962 19:40622680-40622702 TGATGGGGACACAGGGCTGAGGG + Intronic
1166343499 19:42151766-42151788 TGGTGGGGGCAGATGGTAGAAGG + Intronic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1167634966 19:50649100-50649122 ACGTGGGGACAGAGGGGAGGAGG + Intronic
1167781348 19:51601187-51601209 TGGTGGGGAGAGACGGGAGAGGG - Intergenic
1168046882 19:53800508-53800530 AAGAGGGGACAGAGAGCAGAAGG + Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
1168536729 19:57176997-57177019 GAGTGGGGAAAGAAGGCTGAAGG - Intergenic
925274755 2:2640939-2640961 TAGAGGGGACAGAGGCAGGAGGG + Intergenic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
926446526 2:12949110-12949132 TAGTGTGGATAGAGGGCAAGCGG - Intergenic
926829934 2:16950661-16950683 TTGTGGGGACAGAAGACAAAGGG - Intergenic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
927853078 2:26511987-26512009 TGCTGGGGCCAGAGGGCAGTGGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928457356 2:31434562-31434584 TAGTGGGGAGAAAGGGCTGCTGG + Intergenic
928481859 2:31691606-31691628 AAGTTGGGACACAGAGCAGAAGG + Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929075297 2:38075388-38075410 TGCTGGGGACAGAGAGGAGAAGG + Exonic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929782577 2:44966501-44966523 TAGTCAGGACAGAGGACAGAGGG + Intergenic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
930645536 2:53902724-53902746 TAGTTGAGACAGAGAGCAAATGG - Intronic
931434776 2:62236704-62236726 CAGTGGGGTCAAAGGGCAAAAGG - Intergenic
932054951 2:68433784-68433806 TCTTGGGGACACAGGGCACAAGG + Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932773103 2:74512771-74512793 TAAATGGGACAGAGGGCAGTGGG - Intergenic
932950886 2:76291553-76291575 TAGTTGGGACAGAGACCATATGG - Intergenic
933425341 2:82104385-82104407 TGGTGGGCACAGAGAGGAGAGGG - Intergenic
933807716 2:86012189-86012211 TGGTGGGAGCACAGGGCAGAGGG - Intergenic
935062612 2:99621585-99621607 TGGTGGGGACAGAAGGCACAAGG + Intronic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936095160 2:109525721-109525743 TAGTAAGGACAGTGGCCAGAGGG - Intergenic
936121822 2:109752904-109752926 TCATGGAGACAGAGAGCAGAAGG - Intergenic
936222873 2:110618568-110618590 TCATGGAGACAGAGAGCAGAAGG + Intergenic
936518423 2:113197084-113197106 TAGGGGGAAAAGAGGGCAGGTGG + Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
937242860 2:120473894-120473916 TAGTAACGACAGAGGCCAGAGGG - Intergenic
937311680 2:120906730-120906752 GAGAGGGGACACAGGGGAGAAGG - Intronic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937387926 2:121453908-121453930 TTCTGAGGGCAGAGGGCAGAGGG + Intronic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937713030 2:124999357-124999379 TGGTGGGGACAGATGGTGGATGG + Intergenic
938376227 2:130808459-130808481 TAGTGGGAACAGAGAGCTGAAGG + Intergenic
939170654 2:138691096-138691118 TAGTGTGGAGAAAGGGCACAAGG + Intronic
939939214 2:148328604-148328626 AAGTGGTGACAGAGGGCACCTGG - Intronic
940384746 2:153057809-153057831 TAGTGGGGAGGGAGGGCATGGGG - Intergenic
941694673 2:168538297-168538319 AAGTGGGGTCAGAGAGCAGCAGG - Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
944056835 2:195530804-195530826 TAGTTGGGACTGATGGCAGATGG - Intergenic
944405948 2:199383882-199383904 TAATGGGGATAGAAGTCAGAGGG + Intronic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
946048724 2:216843047-216843069 AAGAGGGGACTGAGGGCTGAGGG + Intergenic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
947074252 2:226324839-226324861 CAGAGAGGACAGAGGGCAGTGGG + Intergenic
947531944 2:230914883-230914905 TAGTTGGGAGAGAGAGCAGGAGG + Intronic
948059145 2:235030854-235030876 TGGTGTGGACTGAGTGCAGAGGG - Intronic
948380144 2:237545039-237545061 GAGTGGGGACAGTGGGTGGAGGG + Intronic
948566004 2:238886667-238886689 GGGTGGAGACAGAGGGCAGGTGG + Intronic
948640065 2:239370090-239370112 TCCCGGGGACACAGGGCAGACGG - Intronic
948753700 2:240146574-240146596 GGATGGGGACACAGGGCAGAGGG + Intergenic
1169068210 20:2706362-2706384 TGATGGGGACGGAGGGCATAGGG - Intronic
1169216775 20:3798699-3798721 TAGTGGGGACAGTGGCCACTGGG + Intronic
1169423474 20:5477952-5477974 GAGCTGGGACAGAGGGAAGAAGG - Intergenic
1169427525 20:5508326-5508348 GAGCTGGGACAGAGGGAAGAAGG + Intergenic
1170996799 20:21369093-21369115 TCGTGGAGACAGAGAGTAGAAGG - Intronic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171953820 20:31443837-31443859 TAGTGGTGACAGAGGTTAAATGG + Intronic
1171995915 20:31731218-31731240 TGATGGGGACAGGGAGCAGAAGG + Intergenic
1173193431 20:40894467-40894489 TAGTTGTGACAGAGGTCATACGG - Intergenic
1173293509 20:41734879-41734901 TGGTGGCGACAGTGAGCAGAGGG - Intergenic
1173358562 20:42318797-42318819 TAGAGGGGAAAGATGACAGAAGG - Intronic
1173519848 20:43691122-43691144 AAGTGGCCAAAGAGGGCAGAAGG - Intronic
1174578425 20:51553912-51553934 GAGGGGGGACAGTGGGCCGACGG - Intronic
1175114588 20:56673278-56673300 TAGTAGGGCCAAAGGGCAAAGGG - Intergenic
1175487291 20:59355448-59355470 GAGAGGGGAGAGAGGGGAGATGG - Intergenic
1175730718 20:61352130-61352152 TAGTGAGGGCAGAGTGCAGACGG - Intronic
1175873104 20:62217556-62217578 TGGTGGGGGCAGGGGGCAGGAGG + Intronic
1176104557 20:63379801-63379823 TAATGGTGGCAGGGGGCAGATGG + Intergenic
1176289864 21:5038084-5038106 GAGGGGGGACAGTGGGGAGAGGG - Intronic
1176992654 21:15517422-15517444 TAGTGGGGGCAGAGTGGAGTGGG + Intergenic
1177126349 21:17198035-17198057 AAGAGGGAACAGTGGGCAGATGG - Intergenic
1177273278 21:18875841-18875863 AAGTGGTGACAGAGGGCACCTGG - Intergenic
1177856918 21:26410107-26410129 GATTAGGGACAGAGGACAGAGGG - Intergenic
1178226497 21:30725350-30725372 TAGAGAGGAGAGAGGCCAGAAGG + Intergenic
1178743941 21:35229454-35229476 TAGTCGTGACAGAGGCCAGATGG + Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178790257 21:35693255-35693277 TGGAGGGGACAGGGGACAGAGGG - Intronic
1179082920 21:38190078-38190100 TAGTTAGGACAGAGGCCATATGG + Intronic
1179478043 21:41660279-41660301 TGGTGGGGAGTGGGGGCAGAGGG - Intergenic
1179585918 21:42374054-42374076 GCGTGGGCACAGAGGGCAAAGGG - Intronic
1179807267 21:43847632-43847654 GGGAGGGGACAGAGGCCAGATGG + Intergenic
1179867387 21:44225555-44225577 GAGGGGGGACAGTGGGGAGAGGG + Intronic
1181530152 22:23512815-23512837 AGGTGGGGTCAGAGGGCAGATGG + Intergenic
1181895053 22:26099865-26099887 TGGTGGGGACAGGGGTCAGAAGG - Intergenic
1183214323 22:36469319-36469341 CAGTGGCTACAGAGGGCACAAGG + Intronic
1183701887 22:39455794-39455816 TAGTTGGGACAGAGACCATATGG + Intergenic
1184478147 22:44732390-44732412 AGGTGGGCACAGTGGGCAGAGGG + Exonic
1184655735 22:45941206-45941228 TAGGGAGGAAAGAGTGCAGAAGG + Intronic
1185324666 22:50219822-50219844 TTGTGGGGACAGCGTGCAGTGGG - Intronic
1185339470 22:50285053-50285075 TATCGGGGACAGAGGCCAGGAGG - Intronic
949867072 3:8555124-8555146 TTGTGGGGAAATGGGGCAGAGGG - Intronic
950542921 3:13622812-13622834 TAGCTGGGACTCAGGGCAGACGG + Intronic
950800152 3:15544215-15544237 TAGTCAGGAGAGAGGGCAGTGGG - Intergenic
950809181 3:15635014-15635036 TAGTATGGATAGAGGGCAGAGGG + Intronic
952218657 3:31302530-31302552 TAGTTGGGACAGAGCGCATATGG - Intergenic
953108098 3:39905597-39905619 AAGCTGGGACACAGGGCAGAAGG - Intronic
953294416 3:41699230-41699252 TGGTGGGGACATAGAGCAAATGG - Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
953930796 3:47004827-47004849 TAGAGGGGTCACAGGGGAGAAGG - Intronic
955028540 3:55193603-55193625 TCATGGAGACAGAGGGTAGAAGG - Intergenic
955393385 3:58537126-58537148 CAGTGCGGACACAGGACAGAGGG - Exonic
955502453 3:59598597-59598619 TGGTGGAGAGACAGGGCAGAGGG + Intergenic
955975528 3:64476037-64476059 AAGTGGTGACAGACGGCACATGG + Intergenic
956637305 3:71379071-71379093 TAATGAGGGCAGAGGGAAGAAGG - Intronic
956719761 3:72107472-72107494 TAGTTGTGACAGGGAGCAGAGGG - Intergenic
958021179 3:87998100-87998122 TAGTGAGGACAGTGGAGAGAGGG - Intergenic
959097954 3:101976169-101976191 TAGTGGGGAGAGAGGGAATGGGG + Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961471460 3:127115754-127115776 GAGTGGGGACAGGGGCAAGAAGG + Intergenic
961563224 3:127745856-127745878 AAGTGGGGACAGAAGGCACAGGG + Intronic
962412610 3:135154384-135154406 TTCTGGTGACAGAGGCCAGAAGG + Intronic
962425804 3:135268458-135268480 AAATGGGGACAGAGGTCATAAGG - Intergenic
962462888 3:135630911-135630933 TGGTGGGCAGAGAGTGCAGAGGG + Intergenic
962672532 3:137723733-137723755 TAGGTGGGAAAGAAGGCAGATGG - Intergenic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
964097880 3:152954458-152954480 TAGTCATGACAGAGGGTAGATGG - Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964834172 3:160919274-160919296 TAGTTGTCACAGAGGCCAGATGG - Intronic
965505632 3:169511867-169511889 TAGTTGGGAGAGAAGGCTGATGG - Intronic
965684376 3:171286083-171286105 TGCTGGGGAGAGAGGGGAGAGGG + Intronic
966135692 3:176695714-176695736 TAGTGTGGACAGAGACAAGACGG + Intergenic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967232888 3:187357369-187357391 TATTGGGGACAGAAATCAGAGGG + Intergenic
968489517 4:882522-882544 TGGAGGGGACAGATGACAGATGG - Intronic
968651657 4:1762543-1762565 GAGTCAGGGCAGAGGGCAGAAGG + Intergenic
968974750 4:3816189-3816211 CAGAGGGCACAGAGGTCAGAGGG - Intergenic
969362970 4:6676921-6676943 TGGTGGGCACCGAGGTCAGAGGG + Intergenic
969520713 4:7676275-7676297 AGGTGGGGTGAGAGGGCAGAGGG - Intronic
969715339 4:8865646-8865668 CAGTGGGGAGAGGGGTCAGAAGG + Intronic
970332767 4:15002804-15002826 TGGTGGCGACAGTGGGCCGAAGG - Exonic
971797049 4:31241793-31241815 CACTGGGGACAGAGGTCAAATGG + Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
972694667 4:41433901-41433923 GAGGGAGGACTGAGGGCAGAGGG + Intronic
975617016 4:76256680-76256702 TTCTGGGAACAGAGGACAGAAGG - Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978305684 4:107325862-107325884 TACTTTGGACAGAGGGAAGAGGG + Intergenic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
981825617 4:148937512-148937534 TACTGGGGTGAGGGGGCAGAAGG - Intergenic
981911592 4:149987684-149987706 TATTGGACACAGAGGGCAGCTGG - Intergenic
982629693 4:157816756-157816778 TAGTGGTGAGAGAAGGTAGATGG + Intergenic
982807300 4:159782413-159782435 GTGTGGGGATAGAGGGCATATGG - Intergenic
983217647 4:165017021-165017043 TAGTGAGGACAGATGGGACAGGG - Intergenic
984816626 4:183843535-183843557 TAGTGGTGACAGAGACCATATGG - Intergenic
984921650 4:184769596-184769618 TAGAAGGAACAGATGGCAGATGG + Intronic
985233758 4:187850181-187850203 TAGAGGGCACAGAGATCAGAGGG - Intergenic
985706791 5:1406135-1406157 GAGTGGGGGCAGTGGGCAGACGG + Intronic
985775799 5:1841152-1841174 GAGGAGGGACAGAGTGCAGAGGG - Intergenic
986170072 5:5307882-5307904 AAGTGGGGATATAGAGCAGAGGG - Intronic
986189585 5:5482681-5482703 TAGTGTGGGCTGAGGGCAAAGGG + Intronic
986347105 5:6845890-6845912 TAGTGAGGAGAGAGGAAAGAAGG + Intergenic
986669864 5:10133243-10133265 GTGTGGGGACAGAGGGGATAAGG - Intergenic
987810243 5:22825822-22825844 TACTGGTGGCAAAGGGCAGAAGG + Intronic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988706911 5:33735627-33735649 TTGTGGGGTCAGGGGGCAGTTGG - Intronic
989478007 5:41896431-41896453 AAGAGGGAACAGAGGCCAGAAGG + Intergenic
990544967 5:56814459-56814481 GAGTGGGGACAGAGGGAACCCGG + Intergenic
991207812 5:64069603-64069625 AAGTGGGGACAGATAGCTGAGGG - Intergenic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
992201970 5:74393613-74393635 GAGTGGGGACAAGAGGCAGAGGG + Intergenic
992643779 5:78793395-78793417 TAGTGGGGACAGGGAGGAGCAGG + Intronic
992789274 5:80198976-80198998 TAGTGGTGGCAGTGGGCACAGGG - Intronic
993014448 5:82519716-82519738 TTGTGGGGAATGTGGGCAGAGGG + Intergenic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
994276509 5:97844671-97844693 TTTTGTGGACTGAGGGCAGAAGG + Intergenic
997893319 5:137694423-137694445 TAGTGGGGAGAGAGTTCAGGTGG - Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999234064 5:150079993-150080015 GAGTGGGGACAGAGAGCCGGCGG - Intronic
999284395 5:150385627-150385649 GAGTGGGGAGAGGGGGCTGATGG - Intronic
1000883057 5:166719239-166719261 GAGTTGGGACAGAGACCAGATGG - Intergenic
1001178222 5:169493034-169493056 TCATGAAGACAGAGGGCAGAAGG + Intergenic
1001600333 5:172924175-172924197 TAGTGCCCAGAGAGGGCAGAGGG - Intronic
1002549198 5:179974460-179974482 TACTGTGGACAGATGGCAGTTGG - Intronic
1002595414 5:180318674-180318696 TGGTGGCCACAGAGGGCAGGAGG + Intronic
1002870675 6:1164878-1164900 TAGTGTGGAGGGAAGGCAGATGG + Intergenic
1003847159 6:10185332-10185354 TGGTGGGGACAGAGAGGAGGAGG - Intronic
1004775954 6:18845027-18845049 TAGCTGGCACCGAGGGCAGATGG - Intergenic
1004959763 6:20773901-20773923 TGATGGGGGCAGAGGGCAGAGGG - Intronic
1005811194 6:29517741-29517763 TAGGAAGGGCAGAGGGCAGAGGG - Intergenic
1005824552 6:29624925-29624947 CAGTGGGGAGCCAGGGCAGAGGG + Intronic
1005979338 6:30824431-30824453 GAGTGGGGACAGATGGGAGATGG + Intergenic
1006670725 6:35728349-35728371 TAGAGGGGCGAGAAGGCAGAGGG - Intronic
1007184036 6:39952312-39952334 TAGTTGCAACAGAGGCCAGATGG - Intergenic
1007337377 6:41163247-41163269 GGGTGGGGACAGAGGGGAGGAGG + Intergenic
1007357389 6:41331650-41331672 GAGCGGGGACAGAGGGGAGCCGG + Intergenic
1007411697 6:41666865-41666887 TAGGTGGGAGAGAAGGCAGATGG - Intergenic
1007766677 6:44164754-44164776 TCGTGGGGCCAGATGGCAGGTGG + Intronic
1009892639 6:69706179-69706201 TAGGTGGGAGAGAAGGCAGATGG + Intronic
1010255553 6:73753190-73753212 TAGTTGGGACAGAGACCATATGG + Intronic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1011325600 6:86147635-86147657 TAGAGGGGACACAAGGTAGAAGG + Intergenic
1011582192 6:88881298-88881320 AAGTGGGGGCAGGGGGCAGAGGG + Intronic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012535857 6:100296005-100296027 TAGGGGAGAGAGAGGGTAGAAGG + Intergenic
1013368973 6:109454462-109454484 TCTTGGGCACAGAGGGCACATGG + Intronic
1013723578 6:113063372-113063394 TCATGGAGAAAGAGGGCAGAAGG - Intergenic
1013762161 6:113531359-113531381 AAGGGGTGACAGAGGGCACATGG + Intergenic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1018672987 6:166194922-166194944 TCATGGGGACAGAGGCCAGGAGG + Intergenic
1019427455 7:984303-984325 GGGTGGGGACAGAGGGAAAATGG - Intronic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019642354 7:2110846-2110868 TGGTGGGGTCTGAGCGCAGACGG - Intronic
1019827920 7:3299961-3299983 TGGTGTGGAAAGGGGGCAGATGG + Intergenic
1019996019 7:4725021-4725043 TGCTGGGGACAGAGGGCAGCAGG - Intronic
1021081172 7:16367223-16367245 TAGGGGGCACAGTGGGCACAGGG - Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1022037161 7:26545387-26545409 TAGAGGGAAAAGTGGGCAGATGG + Intergenic
1022430986 7:30320165-30320187 TATTTGGGACACATGGCAGAGGG - Intronic
1022464497 7:30644195-30644217 TAGTGGTGCCAAAGAGCAGAGGG + Intergenic
1023068973 7:36409450-36409472 TAGTTGTGACAGAGGCCATATGG + Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023195709 7:37636482-37636504 CAGTGGGGACAGAGAGCATCAGG - Intergenic
1023870500 7:44260827-44260849 TGGTGGGGGCAGAGAGGAGAAGG - Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1027268996 7:76510235-76510257 GGGTGGGGACAGAAGGCAGAGGG + Intergenic
1027738239 7:81963368-81963390 TAGAAGGGAGAGAGGGAAGAGGG + Intronic
1027877802 7:83793589-83793611 TGGTGGGGACAGAGGAGAAAAGG + Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1029154389 7:98504813-98504835 TGGTGGGGAGAGAAGGCAGATGG + Intergenic
1031057459 7:117009046-117009068 TAGTTGTGACAGAGAACAGATGG + Intronic
1031489607 7:122370619-122370641 AAGTGGGCACAGAGGGCATTGGG + Intronic
1032507580 7:132447281-132447303 TAATGGGGACAGAGTCTAGAGGG - Intronic
1032664481 7:134021910-134021932 TATTGGGGACAGAGGGAGGGAGG + Intronic
1032739991 7:134729447-134729469 TAGTGGTGGCACAGGGCACAGGG + Intergenic
1032854796 7:135825292-135825314 CAGTGGGGACATAGGCCAGTGGG + Intergenic
1032885529 7:136134170-136134192 TGGTGGGGACAGTGGGGTGAGGG - Intergenic
1033855234 7:145552877-145552899 TAATGGGTACAGAGGGCGGAAGG + Intergenic
1034190949 7:149213238-149213260 TTGAGGGGACCCAGGGCAGAGGG + Intronic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1034601497 7:152261905-152261927 AAGTGGGGTCTGAGGGCTGAAGG - Intronic
1035339964 7:158153843-158153865 TCGGGGGGACAGAGAGCAGCCGG + Intronic
1035357392 7:158284680-158284702 TAGAGGGGACAGAGGTGGGATGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035836160 8:2754410-2754432 GGGTGGGGCCAGAGGGTAGATGG + Intergenic
1035891097 8:3344175-3344197 TAGTGGGGAGACAGGTCACATGG + Intronic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037017169 8:13923408-13923430 ATGTGGGAACAGAGGGCATAAGG - Intergenic
1037522837 8:19697008-19697030 TGGTAAGGACAGATGGCAGAGGG + Intronic
1038356254 8:26831954-26831976 GAGTGGGGACAGAGGCCTGCTGG + Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1038745683 8:30252857-30252879 TGGTGGGGACAGCTGGAAGACGG + Intergenic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039603905 8:38865351-38865373 TGGCGGGGGCAGAGGACAGAGGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1041195356 8:55396347-55396369 TTGTTGGGACAGAGGGCAAGGGG + Intronic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1042262366 8:66872363-66872385 TGGTGGGGTCATAGGGAAGAAGG - Intronic
1042278553 8:67030077-67030099 TACTGGGGAAAGAGGAGAGATGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1044177257 8:89142725-89142747 TAGTGGGAGCAGAGGGCATGGGG - Intergenic
1046387706 8:113525050-113525072 AAGTGGTGACAGACGGCAGCTGG - Intergenic
1047746005 8:127845423-127845445 TGGCTGGGACAGAGGGGAGAGGG + Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048726332 8:137389133-137389155 AAGTGGGGACAGAGAGCAACAGG - Intergenic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049614548 8:143570385-143570407 TGGTGGGGACAGTGAGCAGGTGG + Intronic
1049659035 8:143811550-143811572 TGGTGGGGACTGAAGGCTGAGGG - Intronic
1049687438 8:143944582-143944604 TGCTGGGGACAGGGGCCAGAGGG - Intronic
1049744584 8:144257842-144257864 TTGTGGGGACAGAGGTCCAAAGG + Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049939512 9:531777-531799 CAGTGAGGACAGACGCCAGAAGG - Intronic
1050362285 9:4841639-4841661 TTGTTGGAACAGAGTGCAGATGG - Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1051087776 9:13370698-13370720 TAGTGGGGACACAGAGATGAAGG - Intergenic
1051987216 9:23105342-23105364 AAGGGGGGACAGATGGCACATGG + Intergenic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1055997834 9:82180958-82180980 TAGTGGGGACTGAGGGGGCAGGG + Intergenic
1057139940 9:92720260-92720282 GAGTGGGGACAGCGTGCCGAAGG + Intronic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057885935 9:98829649-98829671 TCATGGAGACAGAGAGCAGAAGG - Intronic
1058110070 9:101022974-101022996 TAGTTGTGACAGAGGCCATATGG + Intergenic
1058113445 9:101056986-101057008 GGCTGGGGACACAGGGCAGAGGG - Intronic
1058880001 9:109277777-109277799 GGGAGGGGACAAAGGGCAGAAGG + Intronic
1059300354 9:113307642-113307664 AAGAGGTGGCAGAGGGCAGAAGG + Intergenic
1059606138 9:115838540-115838562 AAGCGGGGAAAGAGGGCAGGAGG + Intergenic
1060504042 9:124184815-124184837 ATGTGGGGGCAGAGGGCATATGG - Intergenic
1060551097 9:124485836-124485858 TGGTGGGGAGCGAAGGCAGATGG - Intronic
1060879466 9:127107951-127107973 GAGTGGGCATAGTGGGCAGAGGG + Exonic
1061016966 9:127986932-127986954 TGGTGGAGACAGAAGACAGAAGG - Intergenic
1061250223 9:129422059-129422081 AGGTGGGGTCAGAGGGCAGATGG - Intergenic
1061482444 9:130903675-130903697 TTATGGGGACAGAGAGCAGGGGG - Exonic
1061501851 9:131008674-131008696 CTGTGGGGACAGAGCGCAGCCGG + Intergenic
1061719327 9:132542142-132542164 TACTGGGGACAGAGGCCTGGCGG - Intronic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1185543863 X:926231-926253 AGGTGGGGACAGAGTCCAGAGGG - Intergenic
1186932962 X:14414788-14414810 TAGTAGGGACAGAGAGAAGAGGG + Intergenic
1187028229 X:15457932-15457954 TAGTGGCAACAGAGGCCATATGG + Intronic
1188923979 X:36016334-36016356 TCATGGAGACAGAGAGCAGAAGG - Intergenic
1189845594 X:45133495-45133517 TCGTGGAGACAGAGAGTAGAAGG - Intergenic
1190741471 X:53291728-53291750 GAGTGGGGTGAGAGGGCAGTTGG - Intronic
1192623765 X:72706781-72706803 TAGTGGGGCTAGAGGGTAAAGGG - Intronic
1195025333 X:100871273-100871295 TAGTTGGGACAGAGACCATATGG + Intronic
1195520812 X:105826492-105826514 TACTGGGCACAGAAGGCAAAGGG - Intronic
1196154551 X:112413660-112413682 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1196742951 X:119041285-119041307 TAGTGGTGAGAGAGGTCAGTTGG + Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197229516 X:123988965-123988987 TGGTGGGGGCTGAGGGGAGAAGG - Intronic
1199102184 X:143815496-143815518 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199334939 X:146607523-146607545 AAGTGGGGAGAGTGGGCTGAGGG + Intergenic
1199589888 X:149457546-149457568 GAATGGAGACAGAGGGGAGATGG + Intergenic
1199711460 X:150472661-150472683 TAATGGGGAGAGAGGGAGGAGGG + Intronic
1201441421 Y:14012769-14012791 AAGGGGTGACAGAGGGCACATGG + Intergenic
1201443149 Y:14029938-14029960 AAGGGGTGACAGAGGGCACATGG - Intergenic