ID: 1117378878

View in Genome Browser
Species Human (GRCh38)
Location 14:55140112-55140134
Sequence TCTTTGGCCCCTGGGCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117378878 Original CRISPR TCTTTGGCCCCTGGGCAAAG TGG Intronic
901196695 1:7444268-7444290 TCCTGGGGCCCAGGGCAAAGAGG - Intronic
902808978 1:18877657-18877679 TTTTGGGCCCCTGGGCAACCGGG - Intronic
903223904 1:21884459-21884481 TCTGTGCCCCCTGGGTACAGAGG + Intronic
904130140 1:28269272-28269294 TCTTTGGTCCCTGGGAAGAAAGG + Intronic
904276134 1:29385510-29385532 TCTGGGGTCCCTGGGCCAAGAGG - Intergenic
905519874 1:38589438-38589460 AGTTTGGCCCCTGGCCAGAGAGG - Intergenic
907866517 1:58404611-58404633 TCTGTGGCTCTTGGTCAAAGGGG - Intronic
908338047 1:63147616-63147638 TTTCTGGCCCCTGGTCAGAGAGG - Intergenic
909290569 1:73878137-73878159 TTTTTGGTCCCTGAGCAAGGAGG - Intergenic
910680896 1:89863319-89863341 TCTGTGGCCCCTGGAGGAAGAGG + Intronic
912653822 1:111467693-111467715 TCTTTGACACCTGGTCGAAGAGG + Intergenic
912689639 1:111794688-111794710 TCTTTTGCCCCCGGACAAGGAGG - Intronic
915873815 1:159590786-159590808 TCTTGGGTTCCTAGGCAAAGGGG - Intergenic
916716518 1:167451364-167451386 CCTTGGGCCCCTGGGCTAACTGG + Intronic
917976719 1:180244706-180244728 CCCTTGGCTCCTGGGCAAAAGGG - Intronic
918271987 1:182910736-182910758 TCTTTGGGCCTTGTGCAAACAGG + Intronic
918450059 1:184649373-184649395 TCTCTGGACCCTGGGAGAAGAGG + Intergenic
920308685 1:205035200-205035222 TCTTTGTACCCTGAGCATAGTGG - Intergenic
920342881 1:205286652-205286674 CATTTGGCCCCTGGGGAAACTGG + Intergenic
920426364 1:205879717-205879739 TTTTGGGCCCCTGGGCAGAGAGG + Intergenic
924666840 1:246082143-246082165 GCTCTGGTCCCTGAGCAAAGAGG - Intronic
924840659 1:247706990-247707012 TCTTTGGCCCATGGACAAAGTGG - Intergenic
1063436676 10:6037592-6037614 GCTTGGGCCACTGGGTAAAGAGG + Intronic
1068169938 10:53380112-53380134 TTTATGGCTCCTGAGCAAAGGGG + Intergenic
1069110899 10:64444844-64444866 TCTCTGGCCCTTGGGCCTAGAGG + Intergenic
1073465865 10:103694186-103694208 TCTTTGGCCCCTGGGGAAAATGG - Intronic
1073564104 10:104520722-104520744 TGTTTGGCAACTGGGCAGAGAGG + Intergenic
1076015168 10:127021940-127021962 TCTTTGGCTCCTTGGGAGAGCGG + Intronic
1076072039 10:127497893-127497915 TGTTAGGCCCCTGGAAAAAGTGG + Intergenic
1076135647 10:128044280-128044302 TCTAGGGCCCCTGGGGAAGGAGG + Intronic
1076396748 10:130144244-130144266 TTTCAGACCCCTGGGCAAAGTGG - Intronic
1077919550 11:6632361-6632383 TCTGTGGCTCCAGGCCAAAGGGG + Exonic
1078501205 11:11879421-11879443 TCTTTTACCCCTGTGGAAAGTGG + Intronic
1080443979 11:32320654-32320676 GCTTTTGCTCCTGGGCAAAGAGG - Intergenic
1081049039 11:38314946-38314968 TCTTTCATCCCTGGACAAAGAGG + Intergenic
1083453486 11:62762291-62762313 TGTGTGGTCCCTGGGCACAGGGG - Intronic
1087709285 11:101530683-101530705 TGTTTGGTCCCTGGGCAGACTGG - Intronic
1087902067 11:103651949-103651971 TTTTTGGTCCCTGAGCAAGGAGG - Intergenic
1088602937 11:111499250-111499272 TCTTTAGCCCCTAAGAAAAGTGG + Intronic
1089706388 11:120280999-120281021 TCTTTGCCCCCAAGTCAAAGAGG + Intronic
1090942737 11:131402425-131402447 TATTTGGCCACTGGGCAAGCAGG - Intronic
1090965959 11:131597875-131597897 TCTTTTCACCCTGGGCAAAAAGG - Intronic
1091099252 11:132854994-132855016 GCTTTGGTCCCTGGGCAAGGAGG - Intronic
1094024802 12:25951177-25951199 TTTTTGGTCCCTGAGCAACGAGG + Intergenic
1099585059 12:84505053-84505075 TCTTTGGCCTCTGGTAGAAGAGG + Intergenic
1102657276 12:114492630-114492652 TCTATGCCTCCTGAGCAAAGAGG + Intergenic
1103021393 12:117537699-117537721 TCTTTGGGGACTGGGCTAAGGGG - Intronic
1103748139 12:123140253-123140275 CCTGTGGCCACTGGGCTAAGAGG - Intronic
1104004082 12:124880029-124880051 TCAGTGGGCCCTGGGCAGAGCGG - Intronic
1104340874 12:127947258-127947280 TTTTTGGTCCCTGAGCAAGGAGG - Intergenic
1104576911 12:129974371-129974393 CCTTTGACCCCTGGGGAGAGGGG - Intergenic
1106612951 13:31300895-31300917 TTTTTGGTCCCTGAGCAAGGAGG + Intronic
1106742835 13:32665302-32665324 TCTTTGGGGGCTGGGCACAGTGG + Intronic
1112502356 13:99952932-99952954 TCTTTGGCCCCTGGCAAGATTGG - Intergenic
1115336197 14:32246272-32246294 TCTTTGGCCTCCTGCCAAAGAGG + Intergenic
1116143789 14:41037499-41037521 TCTTGGGCACCTGGGGAAAGTGG - Intergenic
1116967457 14:51029402-51029424 GCTTTGGCTCCTGGGCCCAGTGG - Intronic
1117378878 14:55140112-55140134 TCTTTGGCCCCTGGGCAAAGTGG + Intronic
1119875245 14:78053881-78053903 TGTATAGGCCCTGGGCAAAGGGG + Intergenic
1120259049 14:82159456-82159478 GCTTTGATCCCTGAGCAAAGAGG - Intergenic
1120276221 14:82376491-82376513 TCTTTGCCGGCTGGGCACAGTGG - Intergenic
1122126972 14:99584485-99584507 TCTTTGGTCTCTGTGCAAGGGGG - Intronic
1123418252 15:20108085-20108107 TCTGGGGCCCCTGTGGAAAGAGG - Intergenic
1123527470 15:21114607-21114629 TCTGGGGCCCCTGTGGAAAGAGG - Intergenic
1127426631 15:58864956-58864978 TCTTTGCACCCTGGGCCACGCGG + Intergenic
1129230059 15:74192157-74192179 TCTTTGGACTTTGGTCAAAGAGG - Intronic
1129416897 15:75388764-75388786 TCTTTGGCATATGGGCAAAAAGG + Intronic
1129845718 15:78766907-78766929 TCGGTGGCCCCTGGGCACACTGG - Exonic
1131017532 15:89070541-89070563 TCTTTGGCCCATGGGGTATGTGG - Intergenic
1131072384 15:89474424-89474446 TCTGTGGCTCCTGGGACAAGGGG - Intronic
1131183026 15:90253427-90253449 TCTTGGGTGCCTGGGCAAGGAGG - Intronic
1132420363 15:101660794-101660816 TCAATGGCTCATGGGCAAAGTGG - Intronic
1132991075 16:2794488-2794510 TTTTTGGTCCCTGAGCAAAGAGG - Intergenic
1134287573 16:12875529-12875551 GCCTTGGCGCCTGGGCACAGTGG - Intergenic
1141436528 16:84002737-84002759 TATTTGGCGCCTGGGCACAGTGG - Exonic
1143085366 17:4412184-4412206 TCTTGGGCTTCTGGGCCAAGCGG + Intergenic
1144658348 17:17052286-17052308 TGTTTGGCCCCGGGGCAGATGGG + Intronic
1147895438 17:43747991-43748013 CTTTTGGCCTCTGGGCAGAGCGG + Intergenic
1148642360 17:49197628-49197650 TTTTTGGTCCCTGAGCAAGGAGG + Intergenic
1149412931 17:56427603-56427625 ACTCTGGCCCCTGGGGAAAGGGG + Intronic
1150061364 17:62071473-62071495 TCTTTGGCCTCAGGCCGAAGAGG + Intergenic
1150335594 17:64328277-64328299 TCTTTGCTCCCTGGGCAGTGCGG - Intronic
1152359823 17:79826823-79826845 TCTTAGTACCCTGGGGAAAGGGG - Intergenic
1152822767 17:82445615-82445637 GGTTTGGCCCCTGGGGAGAGTGG - Intronic
1155063255 18:22247214-22247236 TCTCTGCCCTCTGGACAAAGGGG + Intergenic
1155540718 18:26865256-26865278 TCTTTTGCCCCAGAACAAAGCGG + Intronic
1157320759 18:46632094-46632116 CCTTTGTCCCCTGTGCAACGTGG + Intronic
1160419202 18:78732557-78732579 TCTTTGTCCCCTGTGAGAAGGGG - Intergenic
1161297114 19:3525769-3525791 CCTCTGGCCACTGAGCAAAGGGG - Intronic
1161756776 19:6139714-6139736 ACTTTGTCCCCTGGGGGAAGTGG - Intronic
1162145012 19:8608239-8608261 TCTTTGGAGCCTGGGCAGGGAGG + Exonic
1162187637 19:8918290-8918312 TCTTTGGAACCGGGGCAGAGGGG + Intronic
1162470191 19:10868461-10868483 TGTTTTGCCCATGGGCAAATGGG + Intronic
1162746945 19:12804119-12804141 TCCTTGGCCCGTGGGGAAAGTGG + Intronic
1163148339 19:15397304-15397326 TCTTAGGCACCTGGGCCCAGTGG - Intronic
1166666268 19:44682432-44682454 TGTGAGGCCCCTGGGCAGAGGGG - Intronic
1166698007 19:44865258-44865280 TCCTGGGCTCCTGGGCAGAGAGG - Exonic
1167401940 19:49278687-49278709 TCTTAGGCCTCTGGACAAAAGGG + Intergenic
925339571 2:3126776-3126798 TCTCTGGCCCTTGGGCAAGCTGG - Intergenic
927201088 2:20578461-20578483 TCTTTGGCCCTTGGACAACCGGG + Intronic
927866514 2:26591360-26591382 TCTTTGGCCTGTGGGCACAGAGG + Intronic
928158455 2:28897894-28897916 TCTTTGGAGCCTGGGGGAAGAGG + Intronic
929437163 2:41937790-41937812 TCACTGGGCCTTGGGCAAAGAGG + Exonic
931412392 2:62045490-62045512 TTTTTGGTCCCTGAGCAAGGTGG + Intronic
932577824 2:72972456-72972478 TCTTGGGAACCTGGGCTAAGGGG + Intronic
934608608 2:95717685-95717707 TCTTTGGCACCTTAGCAAAATGG + Intergenic
935361439 2:102250020-102250042 TCCTTGGTCCCTGGGCAGCGTGG + Intergenic
935506346 2:103908963-103908985 TCTTTGGCCCATTTGTAAAGTGG + Intergenic
935756570 2:106280813-106280835 TGTTTGGACCCTGGGACAAGAGG - Intergenic
937007939 2:118535322-118535344 CCTTTGTGCCCTGGGCAAATGGG - Intergenic
937148874 2:119672270-119672292 GCATTGGCCACTGGGGAAAGGGG - Intergenic
937435528 2:121877263-121877285 CCCTGGGCCCCTGAGCAAAGAGG - Intergenic
938000073 2:127726610-127726632 ACCTTGGCCCCTGAACAAAGGGG - Intronic
939955853 2:148527165-148527187 TATTTGGCCCCTGGGAAGTGTGG - Intergenic
943640355 2:190351227-190351249 TCTTAGGCACCTGGGCCATGGGG - Intronic
944822588 2:203445642-203445664 TCTTTGCCGCCTGAGCAAGGAGG + Exonic
944954801 2:204796444-204796466 TCTTCATCCCCTGGGCCAAGAGG + Intronic
945936976 2:215912338-215912360 TCTTTGGCACCTAGAAAAAGTGG - Intergenic
947343118 2:229160758-229160780 TCTTTTGACAGTGGGCAAAGAGG - Intronic
947601232 2:231451730-231451752 GCTTTGGCACCTGGGGGAAGGGG + Intergenic
948769941 2:240246568-240246590 TCTTTGGCTGCTGGCCAAAGTGG - Intergenic
1173477629 20:43372975-43372997 ACTCTGGCCCCTGGACAATGAGG - Intergenic
1174382585 20:50166098-50166120 TCTTTTGCTCCTGGGTAAATAGG + Intergenic
1174663894 20:52239103-52239125 TCTTTGACCCCTGGGTCAATGGG - Intergenic
1174982929 20:55418013-55418035 TCTTTGACTTCTGGGCTAAGTGG + Intergenic
1176229337 20:64023819-64023841 CCCTTGACCCCTGGGCACAGTGG + Intronic
1178120461 21:29464768-29464790 TCTCTGGCCCATGAGCAGAGTGG + Intronic
1180073466 21:45450170-45450192 TCTCTGGTCCCTGGGGAAGGAGG + Intronic
1184549266 22:45195891-45195913 TCTTTGGGCTCTGGGAACAGGGG - Exonic
950027831 3:9832987-9833009 TCTGAGGCACCTGGTCAAAGAGG - Intronic
951867712 3:27325938-27325960 GCTTTGTCCCCTTGGCAAAAAGG - Intronic
956189109 3:66591608-66591630 TCTTTCTTCCCTGGTCAAAGTGG - Intergenic
956671280 3:71693375-71693397 TCTCTGTCCCCTGCTCAAAGAGG - Intronic
956997275 3:74841909-74841931 ACTTTTGCGCCTGGGGAAAGAGG - Intergenic
963643935 3:147890181-147890203 AGTTTGTCCCCTGGGAAAAGAGG + Intergenic
964019185 3:151986520-151986542 CCATTGGCCACAGGGCAAAGTGG + Intergenic
965929521 3:174026003-174026025 TCTTTGGCCTCTGGGAATATAGG - Intronic
967389817 3:188944745-188944767 TCTTTGACCCCAAGGCCAAGAGG - Intergenic
969252095 4:5974636-5974658 TCTCTGGCCTCAGGGCAGAGTGG - Intronic
969703116 4:8778580-8778602 CCTGTGGCCCCTGGTCAGAGAGG - Intergenic
970477507 4:16438576-16438598 TCTTTGGCACCTTGGCATACTGG + Intergenic
970518928 4:16863215-16863237 TCTTTGGCACCTTTTCAAAGAGG - Intronic
970647525 4:18139301-18139323 TCTTGGGCTCTTGGGCATAGAGG + Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
972168340 4:36314273-36314295 TCTTTGTTCACTGGGCAAAATGG + Intronic
972683052 4:41325355-41325377 TTTTTGGTCCCTGAGCAAGGAGG + Intergenic
976563976 4:86532653-86532675 TCCTTGGCACCTGAGCCAAGTGG + Intronic
980924332 4:139119576-139119598 CCTTTGGCTCATGGGCCAAGGGG - Intronic
981743215 4:148024927-148024949 TCATTGGCCCTTGAGCAAAATGG + Intronic
984010853 4:174369795-174369817 TCTTGGCCCCCTCAGCAAAGTGG + Intergenic
985242727 4:187947933-187947955 GCTTCGGCCCATGGGTAAAGAGG + Intergenic
988473550 5:31563487-31563509 TTTTTGGTCCCTGAGCAAGGAGG - Intergenic
990736890 5:58874239-58874261 TGCTTTGCCCTTGGGCAAAGTGG - Intergenic
991473463 5:66995059-66995081 TCTATGGCAACTGGGCAAACGGG - Intronic
991564695 5:67992562-67992584 TCTTGGGGCCATGGTCAAAGAGG + Intergenic
993073939 5:83202085-83202107 TCTTTGGCCTCTGGGCAAAAAGG + Intronic
997216134 5:132112516-132112538 CCTTTGGCCACTTGCCAAAGTGG - Intergenic
997227252 5:132218263-132218285 TCTCTGGTCCATGGGCAAGGTGG + Intronic
997423286 5:133786035-133786057 TCTTTTGACCCAGGGCAAAAAGG - Intergenic
997750416 5:136339291-136339313 GTTTTGGTCCCTGAGCAAAGAGG - Intronic
997777371 5:136623093-136623115 TCTTTGTACCCTGGGAAAATTGG - Intergenic
998076010 5:139236930-139236952 TTTTTGGTCCCTGAGCAAGGAGG - Intronic
998926336 5:147130368-147130390 TCTTGGGCCCCTGGGCAGCCAGG + Intergenic
999820450 5:155222653-155222675 TCTATGGCCTCTGTGCACAGAGG - Intergenic
1000847905 5:166304490-166304512 GCTTTGTTCCCTAGGCAAAGAGG + Intergenic
1001208363 5:169786306-169786328 TCTTTGGCCCCTGAGGAATTTGG + Intronic
1002028807 5:176413524-176413546 TCAGTTGCCCCTGGGGAAAGAGG - Intronic
1005532482 6:26721902-26721924 TCTTTGGGTCCTGGGTAATGGGG + Intergenic
1005535918 6:26755692-26755714 TCTTTGGGTCCTGGGTAATGGGG - Intergenic
1005538313 6:26779763-26779785 TCTTTGGGTCCTGGGTAATGGGG - Intergenic
1005997329 6:30939438-30939460 GCTTGGGTCCCTGGGGAAAGGGG + Intergenic
1006859826 6:37164091-37164113 CCTTTGGCCCCTGGGCTCAAGGG - Intergenic
1007620166 6:43207708-43207730 TCTTTGGCCACAGGGGAATGAGG - Intronic
1008215413 6:48782453-48782475 TCTTTGGCGCCGGGGCCAGGGGG + Intergenic
1009006952 6:57799351-57799373 TCTTTGGGTCCTGGGTAATGGGG - Intergenic
1009009165 6:57822113-57822135 TCTTTGGGTCCTGGGTAATGGGG - Intergenic
1009385599 6:63081675-63081697 GCTCTGGTCCCTGGGAAAAGAGG + Intergenic
1010644954 6:78375871-78375893 TCTTTGGCCCCTGGTCATTCAGG - Intergenic
1012944072 6:105447714-105447736 TCCTTGGCCACTGAGCACAGGGG - Intergenic
1017143453 6:151212954-151212976 GTTTTGGCCCCTGAGCAAAGAGG - Intergenic
1017282399 6:152638397-152638419 TTTGTGGCCACTGGGCACAGAGG - Intergenic
1017592682 6:155994027-155994049 TTTTGTGCCCCTGAGCAAAGTGG + Intergenic
1019918952 7:4150704-4150726 ACTTTGCCCCCAGGGCAGAGTGG - Intronic
1021055166 7:16037882-16037904 TCTTTTGCCCCTGAACACAGAGG + Intergenic
1023292778 7:38685768-38685790 TCGTTGGCCCCTGGGCAGCATGG + Exonic
1023500601 7:40845263-40845285 TCTTTGGACTATGGGAAAAGGGG + Intronic
1024924738 7:54600885-54600907 GCTGTGTCCCCTGGCCAAAGTGG + Intergenic
1026163633 7:67890822-67890844 TGGTTGGCAGCTGGGCAAAGAGG - Intergenic
1027233737 7:76286076-76286098 TCTTTGTTCCCCGGGCACAGTGG - Exonic
1027534148 7:79375019-79375041 TGTTTGGGCCCTGGGCAAGGAGG - Intronic
1027682567 7:81238600-81238622 TGTTTGGAGGCTGGGCAAAGTGG - Intergenic
1027688352 7:81307154-81307176 TCTTTGGTCCTTGGCCAATGGGG + Intergenic
1029745933 7:102515953-102515975 TGCTTTGCCTCTGGGCAAAGGGG - Intronic
1029763871 7:102614932-102614954 TGCTTTGCCTCTGGGCAAAGGGG - Intronic
1030607952 7:111658486-111658508 TCTTTGGCACCCTGACAAAGAGG + Intergenic
1032472230 7:132186830-132186852 TCTCTGGTCCCCAGGCAAAGAGG - Intronic
1033168941 7:139066437-139066459 TATTTGTACCCAGGGCAAAGTGG + Intronic
1033466069 7:141590911-141590933 TCTTTGCCACCTGGGCACAGGGG + Intronic
1035311335 7:157970868-157970890 GCTTTGGTCACTGGGCAGAGAGG - Intronic
1036929860 8:12945347-12945369 TCTTTTGCCCCTTGGGAAACTGG - Intergenic
1037362128 8:18084534-18084556 TCTTTGCCCTCTGAGAAAAGCGG + Intronic
1038318945 8:26511404-26511426 TCTGGGGCTCCTGGGCACAGGGG - Intronic
1042521043 8:69711264-69711286 TCTTTGGGACCTGGGGACAGAGG - Intronic
1042734159 8:71969075-71969097 TATTTTGCTCCTGGGCAGAGAGG - Intronic
1042927057 8:73976902-73976924 ACTTTGGTCCCTGGGAAAAGGGG + Intronic
1043552094 8:81386258-81386280 TCTTGGGCCCCTGAGCAACTGGG + Intergenic
1044573790 8:93747352-93747374 TTTTTGGGCCCTGAGCAAGGGGG + Intergenic
1045647986 8:104317857-104317879 TTTTTGGTCCCTGAGCAAGGAGG + Intergenic
1046190613 8:110790076-110790098 TCTTTGGTCCCTGAGCAAGGAGG + Intergenic
1047301077 8:123613856-123613878 TCTTTGGGCCCTGGGCTCTGGGG - Intergenic
1049446973 8:142635673-142635695 TCTCTGGCCCTTTGGCAGAGGGG - Intergenic
1050062504 9:1724706-1724728 ACTGTGGCCCCTGGGCCAAATGG - Intergenic
1051889288 9:21926232-21926254 TCTTTGACCTCTGGCCAAAAGGG + Intronic
1051980698 9:23012133-23012155 TTTTTTTGCCCTGGGCAAAGTGG + Intergenic
1052093634 9:24358606-24358628 TTTTAGGCCCCTTGGCAAAGGGG - Intergenic
1056798961 9:89678178-89678200 TCTTTGACCCCTGGCCAACTCGG - Intergenic
1056964335 9:91153415-91153437 TTTTTGGTCCCTGAGCAAGGAGG + Intergenic
1057920065 9:99090015-99090037 GCTTTGGTCCCTGAGCAAGGAGG + Intergenic
1061499521 9:130993925-130993947 ACTGTGGCCCCTGGGCATGGGGG - Intergenic
1061884026 9:133582628-133582650 TCTTTGTGCCCTGAGCCAAGAGG + Intronic
1185534074 X:845928-845950 TCCGGGGCCCCTGTGCAAAGAGG + Intergenic
1190187195 X:48245532-48245554 TCTTTTCCTCCTGGGCAGAGTGG - Intronic
1191847028 X:65554656-65554678 TTTCTGGCCCCTGGGGAAAAAGG - Intergenic
1194969837 X:100331341-100331363 TCTTTTGCAACTGGACAAAGTGG - Intronic
1196813935 X:119650190-119650212 TCTTTGACCACTGGGCTGAGCGG - Intronic
1198548334 X:137718007-137718029 TTTTTGGCGGCTGGGCACAGTGG + Intergenic