ID: 1117380470

View in Genome Browser
Species Human (GRCh38)
Location 14:55157103-55157125
Sequence ATTGGCAAATGGAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117380464_1117380470 9 Left 1117380464 14:55157071-55157093 CCAGTAAGAATTGAAAGTAGTTG 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1117380470 14:55157103-55157125 ATTGGCAAATGGAATGAGAAGGG 0: 1
1: 0
2: 6
3: 32
4: 388
1117380463_1117380470 19 Left 1117380463 14:55157061-55157083 CCAAAAGACTCCAGTAAGAATTG 0: 1
1: 0
2: 1
3: 42
4: 338
Right 1117380470 14:55157103-55157125 ATTGGCAAATGGAATGAGAAGGG 0: 1
1: 0
2: 6
3: 32
4: 388
1117380462_1117380470 28 Left 1117380462 14:55157052-55157074 CCAGTAAGTCCAAAAGACTCCAG 0: 1
1: 0
2: 1
3: 10
4: 121
Right 1117380470 14:55157103-55157125 ATTGGCAAATGGAATGAGAAGGG 0: 1
1: 0
2: 6
3: 32
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117380470 Original CRISPR ATTGGCAAATGGAATGAGAA GGG Intronic
900537798 1:3187391-3187413 ATGGGCAAATGGCCTGAGCAGGG + Intronic
901264180 1:7897234-7897256 GTTGACCAATGGAATGGGAATGG - Intergenic
902236659 1:15062021-15062043 ATTCTCAACTGGGATGAGAATGG - Intronic
902719749 1:18296046-18296068 ATTAGAAAATGGGATAAGAAGGG + Intronic
902775118 1:18669768-18669790 ATCTGCAAATGAAATGATAATGG + Intronic
903732407 1:25506132-25506154 ATTGGTCAATGGAATGTGAGTGG + Intergenic
904413618 1:30341465-30341487 GTTGGCCAATGGAATGTGACTGG - Intergenic
905925079 1:41743862-41743884 ATTGGGAAATGGAAGGGAAATGG + Intronic
906554491 1:46697650-46697672 ATTTGCTAAAGGAATGAGTAGGG - Intronic
906562586 1:46770136-46770158 CTTGGCAAATGGAAGGAGAAGGG - Intronic
907049832 1:51322338-51322360 ATTGGCAAAGTGAATTTGAAAGG - Intronic
907779789 1:57555911-57555933 ATTGGGAGTTGGAATGAAAAAGG - Intronic
908820949 1:68085995-68086017 TATGGCCAATGGAATGTGAATGG + Intergenic
908838798 1:68257042-68257064 TTTGGCCAATGGAATGTGAGGGG + Intergenic
908968158 1:69791771-69791793 AGTGGTAAATTGAATGAGAGTGG + Intronic
910219447 1:84875796-84875818 TATGAAAAATGGAATGAGAAAGG - Intronic
910768525 1:90807499-90807521 TTTGGCCAATGGGATGATAATGG - Intergenic
911476750 1:98382562-98382584 ATAACCAAATGGCATGAGAAGGG + Intergenic
911682632 1:100735093-100735115 ATTGGCACATTGAAAAAGAAGGG + Intronic
912249242 1:107993656-107993678 GTTGGCAACCGGAATGAGAGGGG - Intergenic
913701003 1:121374426-121374448 TTTGGAAAATGGATTGGGAAAGG - Intronic
914041554 1:144054893-144054915 TTTGGAAAATGGATTGGGAAAGG - Intergenic
914080750 1:144409564-144409586 GGTGGCAATTGAAATGAGAAAGG + Intergenic
914136535 1:144905597-144905619 TTTGGAAAATGGATTGGGAAAGG + Intronic
914175663 1:145278098-145278120 GGTGGCAATTGAAATGAGAAAGG + Intergenic
914530383 1:148519567-148519589 GGTGGCAATTGAAATGAGAAAGG + Intergenic
915291879 1:154889791-154889813 AATGGCCAATTAAATGAGAAGGG + Intergenic
915896841 1:159818396-159818418 ACTGGCATTTGGACTGAGAAAGG - Intergenic
915991522 1:160522052-160522074 ATTGGTAATTGGAATGAGAAAGG - Intronic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
918169928 1:181986917-181986939 ATTGGAAAATGGGCTGTGAAAGG - Intergenic
918930299 1:190846908-190846930 ATGGGCAAATGGGCTGAGCATGG + Intergenic
919154665 1:193748501-193748523 ATTAGCTAAGGGAATGAGAACGG + Intergenic
919218774 1:194597892-194597914 ATTAGAAAATTTAATGAGAATGG - Intergenic
919356136 1:196524304-196524326 ATTGGGAGTTTGAATGAGAATGG + Intronic
919497018 1:198285639-198285661 TTTGGCCAATGAAATGTGAATGG - Intronic
920399097 1:205666073-205666095 ATTGGCAGAGGGCATGAGTAGGG - Intronic
920488422 1:206393144-206393166 TTTGGAAAATGGATTGGGAAAGG - Intronic
920729639 1:208470900-208470922 AATGGAAAATGGGATCAGAATGG + Intergenic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
921807621 1:219474065-219474087 ATTCCAAAATGGAATGAGTATGG + Intergenic
921951877 1:220938649-220938671 ATTGGCAAAGGGAATGTAAATGG + Intergenic
921951895 1:220938822-220938844 ACTGGCCAATAGAATGTGAATGG - Intergenic
922630154 1:227098690-227098712 AGTGGCAAAAGGGATAAGAAGGG - Intronic
924024072 1:239814550-239814572 ATTGGCATCTTGAATGATAAAGG - Intronic
1064224245 10:13468593-13468615 ATTAGGAACTGGAAGGAGAAAGG + Intronic
1064753192 10:18553035-18553057 ATTGGGAAATGGAATGGAGAAGG - Intronic
1064755790 10:18570965-18570987 AATGGAAAATGGAATGGGAATGG - Intronic
1064756060 10:18572682-18572704 AATGGAGAATGGAAGGAGAATGG - Intronic
1065847759 10:29760518-29760540 CTTTGCAAATGGAAGGGGAAAGG + Intergenic
1066453422 10:35551318-35551340 ACTCCCAAATGGAATGGGAAAGG - Intronic
1066972584 10:42326244-42326266 ATTCGAAAATGGAGGGAGAAGGG - Intergenic
1067978788 10:51057538-51057560 ATTGGGAAATGGCATGAGGAAGG - Intronic
1068000291 10:51325614-51325636 ATAGGAAAATGGAATTACAATGG - Intronic
1068499522 10:57825948-57825970 ATTGTCAAATAGGATAAGAATGG + Intergenic
1069097398 10:64276025-64276047 ATTGGCAAATGGAAAATCAAGGG - Intergenic
1069469115 10:68670734-68670756 AGATGCAAATGGAATGAAAATGG - Intronic
1069733470 10:70634716-70634738 ATTGGCTAATTTAAAGAGAATGG + Intergenic
1069761174 10:70812631-70812653 ATTGCCAACTGGAGTGAGCAAGG - Intergenic
1070771046 10:79082538-79082560 TCTGGGAAATGGGATGAGAAGGG - Intronic
1071713376 10:88071563-88071585 ATATGCCAGTGGAATGAGAATGG - Intergenic
1071871068 10:89795290-89795312 ATTGGAAAAAGAACTGAGAAAGG + Intergenic
1072744410 10:97929646-97929668 TCTGTAAAATGGAATGAGAATGG + Intronic
1073608581 10:104920921-104920943 ATTGGCCAATGGCTGGAGAAAGG - Intronic
1073946878 10:108761105-108761127 ACTGGCCAATGTTATGAGAATGG + Intergenic
1073960159 10:108917221-108917243 ATGTGCAAATGTAATGAGAAGGG - Intergenic
1074840832 10:117349271-117349293 AGAGGCAGAAGGAATGAGAAGGG + Intronic
1075152464 10:119946701-119946723 ATTGGCAAATAAAAAGAGATGGG + Intergenic
1076052535 10:127347075-127347097 ATTTGCAAATGGACTATGAAGGG - Intronic
1076136849 10:128051140-128051162 AAGGGGAAATGGGATGAGAAGGG - Intronic
1078081083 11:8205195-8205217 CTTAGCAAATGGAAGGAGAAGGG - Intergenic
1080326508 11:31079876-31079898 AAAGGAAAATGAAATGAGAATGG + Intronic
1084246084 11:67858111-67858133 AGTGGGAACTGGAATGAGATTGG + Intergenic
1084826590 11:71736389-71736411 AGTGGGAACTGGAATGAGATTGG - Intergenic
1085059368 11:73430646-73430668 AGTGGCGAATGGAGTGGGAAGGG - Intronic
1085839488 11:79995096-79995118 GTGGACAAATGGAATTAGAAAGG - Intergenic
1086053939 11:82626395-82626417 TGTGGAAAATGGGATGAGAAGGG + Intergenic
1086392721 11:86381940-86381962 TTTGGCAAAGGGAATGACAGGGG + Intronic
1086579345 11:88379697-88379719 ATTGGCAAATGACATAAGGAAGG + Intergenic
1086685140 11:89725006-89725028 ATAGGCAAACAGAATGACAAAGG - Intergenic
1086881095 11:92154353-92154375 ATAGGGAATTTGAATGAGAATGG - Intergenic
1087392962 11:97562308-97562330 ATGGGCAAATGGGCTGAGCATGG + Intergenic
1087836242 11:102878165-102878187 GTTGGTAAAGGGAATGAGAAGGG - Intergenic
1088126376 11:106429474-106429496 AATGGCAAATGGTGAGAGAAGGG - Intergenic
1089311381 11:117560427-117560449 ATACGCAAATCAAATGAGAAGGG - Intronic
1089523390 11:119080713-119080735 AGTGGCAAATGAATTGAGCAAGG + Intronic
1090869002 11:130726385-130726407 CTTGGCAAATGGAAAGCCAAAGG - Intergenic
1091340139 11:134805305-134805327 AGTAGCAAGTGGAATGAGAATGG + Intergenic
1092416660 12:8295236-8295258 AGTGGAAACTGGAATGAGATTGG + Intergenic
1094262035 12:28511607-28511629 ATTTGCCGATTGAATGAGAATGG + Intronic
1095519706 12:43048694-43048716 ATATGCAAATGTAATCAGAAGGG + Intergenic
1095842425 12:46708152-46708174 ATTGTCAAATTGAATAAAAAGGG - Intergenic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1097448264 12:59703291-59703313 ATTGTTAAATGGTATGAAAAAGG - Intronic
1097986871 12:65793016-65793038 TTTAGCAAATGGAATGTAAATGG - Intergenic
1100204922 12:92338695-92338717 ATTGGGAGATGGAAAGAGAAGGG - Intergenic
1100284432 12:93151832-93151854 ATTTGCAACTGAAAAGAGAAAGG + Intergenic
1100770164 12:97913026-97913048 CTGGGCAAATGGGATGAGTAGGG - Intergenic
1101547421 12:105729273-105729295 TTTGGCCAATGGAATGTTAATGG - Intergenic
1101564242 12:105890546-105890568 AATGTCCAATGGAATGAAAAAGG - Intergenic
1102595545 12:113989715-113989737 ATTGGAAACTGGAGTGAGAGAGG + Intergenic
1102685041 12:114718067-114718089 AAAGGCTAATGGAATGACAAGGG + Intergenic
1102843598 12:116153288-116153310 CTTGGCAAATAGACTGAGAAAGG - Intronic
1102920678 12:116789327-116789349 ATGGGTAAATGGAAAGAGAGTGG + Intronic
1102920783 12:116789776-116789798 ATGGGTAAATGGAAGGAGAGTGG + Intronic
1102920788 12:116789799-116789821 ATGGGTAAATGGAAGGAGAGTGG + Intronic
1103191732 12:119007424-119007446 ATTGGTAAAGGGAAAGAGAGGGG - Intronic
1103891407 12:124241726-124241748 CTTAGCTAATGGGATGAGAATGG - Intronic
1104751533 12:131243091-131243113 TTTGGCCAATGGGATGAGAGAGG - Intergenic
1106698844 13:32207379-32207401 AGTGACAAATGAAATCAGAAAGG - Intronic
1108152059 13:47546338-47546360 ATTCTCACTTGGAATGAGAATGG + Intergenic
1108474108 13:50796675-50796697 TCTGGCCAATGGAATGTGAAAGG + Intronic
1108842659 13:54639154-54639176 GATGGCAAATGAAATGAGATGGG + Intergenic
1109045757 13:57409027-57409049 ATTAACAAAAGGAATGTGAAAGG + Intergenic
1109342443 13:61078203-61078225 AGTGGCAAAAGGCAAGAGAAGGG - Intergenic
1110237222 13:73229508-73229530 AATAGAAAGTGGAATGAGAAGGG + Intergenic
1110466370 13:75806807-75806829 TGTGGCAAATGGAATGAGAAAGG + Intronic
1110629474 13:77690947-77690969 TTTGGTAAATGAAATGTGAATGG + Intergenic
1111223560 13:85239242-85239264 ACTGGCAAATGGAAGAAGAATGG + Intergenic
1111678160 13:91412287-91412309 ATTGGCAAATGGACTAGCAAGGG - Intronic
1111912918 13:94331674-94331696 ATTTCCAAATAGTATGAGAAAGG + Intronic
1111937774 13:94573976-94573998 ATTGGCTATTGGGTTGAGAAAGG - Intergenic
1112274528 13:98004088-98004110 ATTGTCAAATGCAATGAAAATGG + Intronic
1112356463 13:98678029-98678051 ACAGGCAAGTGGAAGGAGAATGG + Intergenic
1113115392 13:106869636-106869658 ATTGGCAAGAGGCAGGAGAAAGG + Intergenic
1114169480 14:20257547-20257569 ATTGACAAATGTAATGTTAAAGG - Intronic
1114297982 14:21347469-21347491 ATTGCCTAATGGGCTGAGAATGG + Intronic
1114877798 14:26743761-26743783 TTTGGCTAATGGAAGGTGAATGG - Intergenic
1115160605 14:30389648-30389670 CTTGTCAAATGTAATGTGAATGG + Intergenic
1115332869 14:32216572-32216594 ATTTTAAAATGGAATGAGATTGG - Intergenic
1115885803 14:37970485-37970507 AATGGCACAAGGATTGAGAAGGG + Intronic
1116116227 14:40654467-40654489 ATAGGTAAATGGATGGAGAATGG + Intergenic
1117270879 14:54142266-54142288 TTTGGCCAATGGAATGAGGGTGG - Intergenic
1117380470 14:55157103-55157125 ATTGGCAAATGGAATGAGAAGGG + Intronic
1117649140 14:57883956-57883978 AATGACAAATGCAAAGAGAAAGG + Intronic
1118443044 14:65829116-65829138 AAAGGCAGATGGAATGAGGAGGG + Intergenic
1118760039 14:68875259-68875281 ATTGGCACATGGAATTAGATTGG - Intronic
1120265050 14:82238010-82238032 ATTGGCAAATTGATTGAAATTGG + Intergenic
1120544701 14:85796521-85796543 ATAGCCAAATGGAAACAGAAGGG + Intergenic
1120907038 14:89629810-89629832 ATTGTCAAAAGGCATGAAAATGG - Intronic
1122111145 14:99503405-99503427 TTTGGTAAATGGAAAGAGGAAGG + Exonic
1122743553 14:103885430-103885452 TTTGGGAGATGGTATGAGAAGGG - Intergenic
1125067291 15:35503532-35503554 AATGAGAAATGGAATGATAAAGG - Intronic
1125828759 15:42696446-42696468 ATGGGAAAATGACATGAGAAGGG + Intronic
1127141121 15:55978251-55978273 GTTGGGAAATGCAAGGAGAAAGG - Intronic
1130972674 15:88746242-88746264 ATGGGCAAAGGGTATGTGAAAGG + Intergenic
1131703413 15:94966015-94966037 ATTCACAAATGGAATGATAGTGG + Intergenic
1132247800 15:100310798-100310820 ACTTGCTAATGGATTGAGAAAGG + Intronic
1133036864 16:3038432-3038454 ATTGGCAAATGCAACGAGCGAGG - Intergenic
1133549045 16:6835949-6835971 TTTGGCAGATGGAATGGGAATGG - Intronic
1134051193 16:11138640-11138662 AGTGGCAAATGGCCAGAGAAAGG - Intronic
1134413210 16:14020719-14020741 ATTGGCAACAGGAAGGAGAATGG - Intergenic
1137965142 16:52924495-52924517 ATTGGCAAATGAATTGATAGAGG - Intergenic
1138537412 16:57667322-57667344 CTTGGCAATTGGAAGGTGAAGGG - Intergenic
1139088203 16:63614690-63614712 ATAGGGAACTGGAAAGAGAAAGG - Intergenic
1139166765 16:64575462-64575484 ATTCTGAAATGGAATTAGAAAGG + Intergenic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1140452748 16:75084164-75084186 TTTGGCCAATGAAATGTGAACGG - Intronic
1141305041 16:82854901-82854923 ATTGTCCAAAGCAATGAGAAAGG - Intronic
1144610779 17:16712340-16712362 ATTGGCAAATGTGAAGAAAAAGG + Intronic
1144878116 17:18413037-18413059 ATTGGAAAATAAAAAGAGAAAGG - Intergenic
1144901966 17:18603046-18603068 ATTGGCAAATGTGAAGAAAAAGG - Intergenic
1144929100 17:18842898-18842920 ATTGGCAAATGTGAAGAAAAAGG + Intronic
1145020202 17:19424282-19424304 ATTGACAAATGGAATAAGAAAGG - Intergenic
1145130538 17:20343028-20343050 ATTGGCAAATGTGAAGAAAAAGG + Intergenic
1145154115 17:20531388-20531410 ATTGGAAAATAAAAAGAGAAAGG + Intergenic
1146423350 17:32711181-32711203 ATTAGTGAATGAAATGAGAAGGG + Intronic
1149116595 17:53104743-53104765 TGTGGTAAATGGAATGAAAAGGG + Intergenic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1153580327 18:6566754-6566776 GTTTCAAAATGGAATGAGAAAGG - Intronic
1154203404 18:12316808-12316830 ATTTGGAAATGGAATGACACTGG - Intronic
1155339893 18:24803267-24803289 ATTGGCACATTGAATAAGGAAGG + Intergenic
1155639426 18:27996224-27996246 AATGCCAAATGGAATGACACAGG - Intronic
1156325958 18:36075498-36075520 AGTGGAAAATGGAATAGGAATGG - Intergenic
1156808003 18:41210225-41210247 AATGGCAAAGGGAAGGAAAAAGG + Intergenic
1157977248 18:52340930-52340952 CTCGCCAAATGAAATGAGAAGGG - Intronic
1158062153 18:53357703-53357725 AATGGTAAATGAAATTAGAAAGG + Intronic
1158835619 18:61328675-61328697 ATTGCCAAATTGCATTAGAAGGG + Intergenic
1162477635 19:10910512-10910534 TCTGGCAAATGGGATGAGAAGGG - Intronic
1165583885 19:36895381-36895403 ATACACAAATGGAAAGAGAAAGG + Intronic
925673711 2:6338414-6338436 AGTCGCAAATGGAACTAGAACGG + Intergenic
925703902 2:6666097-6666119 ATTGGTAAATGGGAGCAGAAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
928055634 2:28051456-28051478 ATTGGCAGCTAGAATGAGAGAGG + Intronic
929270301 2:39964480-39964502 GTAGGCAAAAGGAAAGAGAAAGG + Intergenic
930235011 2:48880425-48880447 ATGGACAAAGGGTATGAGAAAGG + Intergenic
930410840 2:51025098-51025120 ATTGGGAGATGGAGTGATAAAGG - Intronic
930655173 2:54000784-54000806 TTTGGCCAAAGGAATGGGAATGG - Intronic
930689860 2:54350406-54350428 CTTGGCAGATGGACTGAGGACGG + Intronic
930808239 2:55514016-55514038 ATTTGCAAATGCAATGAAAAAGG + Intergenic
932840525 2:75077849-75077871 ATTGGGAAATTGGAGGAGAAAGG - Intronic
935144960 2:100389333-100389355 AGGGGCAGATGAAATGAGAAAGG + Intergenic
936496577 2:113027572-113027594 GTTGGCAAAAGGAATAGGAATGG + Intronic
936613012 2:114019968-114019990 TGTGACAAAAGGAATGAGAATGG + Intergenic
938687258 2:133750907-133750929 TTTTGCAAATGGAAATAGAAAGG + Intergenic
939514419 2:143148749-143148771 AATGTCAAATATAATGAGAAAGG - Intronic
939938542 2:148321700-148321722 GTAAGCAAATGGAATGGGAAAGG - Intronic
940053518 2:149489635-149489657 TTTGGCCAATGAAATGAGACCGG - Intergenic
941039856 2:160609103-160609125 GTTGGTAACTAGAATGAGAAAGG + Intergenic
941317050 2:164006763-164006785 ACTGGCAAAGTGAATGAGTAGGG + Intergenic
942374361 2:175321620-175321642 ATTGGCTGATGGAATTAGATGGG + Intergenic
944036203 2:195297401-195297423 ATTGGTAAATGGAATAGGGAGGG + Intergenic
944278020 2:197861584-197861606 ATTTGCAATTGGCATCAGAATGG + Intronic
944501275 2:200362565-200362587 CCTGGCCAATGGAATGTGAATGG - Intronic
946005798 2:216523937-216523959 ATTGGTAAATCAAATGAGACAGG - Intronic
946667798 2:222068879-222068901 AAAGGCACAAGGAATGAGAAGGG - Intergenic
946970036 2:225081385-225081407 ATAAAAAAATGGAATGAGAATGG + Intergenic
947133552 2:226954666-226954688 ATAGGCAGATGGATTGATAAAGG + Intronic
947395681 2:229684476-229684498 AGAGGGAAATGGAAAGAGAAAGG - Intronic
947552161 2:231053985-231054007 ATTGGGTAATGGAGTGAGGATGG + Intergenic
948492968 2:238325519-238325541 ATGAGAAAATGAAATGAGAAAGG - Intronic
1169044914 20:2527535-2527557 CTTGGCAAAGGGAGTGGGAATGG - Intergenic
1169649940 20:7855772-7855794 TTTTGCCAATGGAATGTGAATGG + Intergenic
1170805543 20:19627521-19627543 CTTGGCAGATGGACTGAGGATGG + Intronic
1170913516 20:20599666-20599688 ATAGGCAAAGGGTAGGAGAAAGG - Intronic
1170913606 20:20600341-20600363 TTTAGGAATTGGAATGAGAAAGG + Intronic
1171238401 20:23546290-23546312 GTTCTCAAATGGAATGAGTAGGG + Intergenic
1172463622 20:35138450-35138472 AGTGACAAATGGAATGAGCATGG - Intronic
1173103908 20:40113348-40113370 ATTGGGAAAGGAAATAAGAAAGG - Intergenic
1173982877 20:47238606-47238628 AATGCCAAATGGAATGTGCAAGG + Intronic
1174888803 20:54367001-54367023 TTTGGCAAATGAAATGTGAATGG + Intergenic
1175186786 20:57184231-57184253 TTTGGCCAATGGAATGTGAGTGG - Intronic
1175349142 20:58306284-58306306 TTTGGAAAATGGCATGAGAATGG - Intergenic
1177154528 21:17487820-17487842 ATTTGCAAAACAAATGAGAAAGG + Intergenic
1178344597 21:31814083-31814105 TTTGGCCAATGAGATGAGAAGGG + Intergenic
1181590055 22:23878557-23878579 TTTGGCCAATGGAATGTTAATGG - Intronic
1183844812 22:40533767-40533789 ATTGGTAACTGCACTGAGAAGGG - Intronic
1184907095 22:47495673-47495695 ATTGGCAGAAGAAATGAGAAGGG - Intergenic
950438831 3:12995385-12995407 ATGGGCAAATGGATCCAGAAAGG + Intronic
951763141 3:26166399-26166421 TCTGGAAAATGAAATGAGAATGG - Intergenic
952137722 3:30442140-30442162 CTTGGCATATGGAATGTGGATGG - Intergenic
952674146 3:36006832-36006854 ATTGGCAAGGAGAATGGGAATGG + Intergenic
953262115 3:41349687-41349709 TTTGACAAATGGAATGAGGGTGG - Intronic
953546827 3:43869729-43869751 TTTGGCCAATGGAAAGAGGATGG - Intergenic
954979249 3:54729239-54729261 ATTGGCAAATGCTATGAGAGGGG + Intronic
955084959 3:55693668-55693690 TGGGGCAAATGGAAAGAGAATGG + Intronic
955552490 3:60099279-60099301 ATTCACAAATGGAATGGGATGGG + Intronic
956112473 3:65883212-65883234 ATTAGCAAATGGCATAAAAAAGG + Intronic
956302741 3:67790284-67790306 CTTGGCAACTGGAGTGAGAGTGG - Intergenic
957661363 3:83158248-83158270 ATAGTCAAGTGGAATGATAAAGG - Intergenic
958696550 3:97535347-97535369 ATAGGAAAACGGATTGAGAAAGG + Intronic
961020321 3:123500304-123500326 TTTGGCAACTGTATTGAGAAGGG + Intronic
961231628 3:125317749-125317771 TTTGGAAAATGAAATAAGAAAGG + Intronic
961533972 3:127558031-127558053 ACTGGCAAATGGAAGGTGGAGGG + Intergenic
961894208 3:130153839-130153861 AGTGGGAACTGGAATGAGATTGG + Intergenic
962403159 3:135078596-135078618 ATGGACAAATGGACAGAGAAAGG + Intronic
963462019 3:145626690-145626712 ATTGGCAAATTGAATGTGAAGGG + Intergenic
964367263 3:155963726-155963748 TATTGAAAATGGAATGAGAAAGG + Intergenic
964367359 3:155964505-155964527 TATTGAAAATGGAATGAGAAAGG - Intergenic
965516782 3:169630048-169630070 ATGGGCAGATGGAAAGAGAGTGG + Intronic
967372799 3:188766761-188766783 ATTAGCAAATAGAAGAAGAAAGG + Intronic
969748559 4:9093237-9093259 AGTGGGAACTGGAATGAGATTGG - Intergenic
969809598 4:9637802-9637824 AGCGGGAACTGGAATGAGAATGG - Intergenic
971181329 4:24330912-24330934 ATGGGCAGAAGGAAAGAGAAGGG - Intergenic
971766523 4:30839264-30839286 ATAGCCAAAAGGAATGAGAAGGG + Intronic
972138677 4:35927431-35927453 ATTTGAAACTGGAATCAGAATGG + Intergenic
972877302 4:43378365-43378387 ATTGGTCAATGAAATGTGAATGG + Intergenic
974561475 4:63527214-63527236 AATAGCAAATGGAAGGTGAATGG + Intergenic
975151154 4:71022210-71022232 ATTGGGAAAGAGTATGAGAAAGG + Intronic
975394037 4:73853971-73853993 GTTTGCAAATGGCATTAGAAGGG - Intronic
975405162 4:73980843-73980865 ATTGGCAAAGGTAATAATAATGG + Intergenic
975405192 4:73981333-73981355 GTTTGCAAATGGCATTAGAAGGG + Intronic
975916277 4:79329507-79329529 AATGGCTCATGGAATAAGAAAGG - Intergenic
976991206 4:91369125-91369147 TTTGGACAATGGAATGTGAATGG + Intronic
978354253 4:107854131-107854153 TTTGCCAGATGGAATGAAAACGG + Intronic
978456966 4:108905125-108905147 TCTGGAAATTGGAATGAGAATGG + Intronic
979569590 4:122203210-122203232 ATTAATAAATGGTATGAGAATGG - Intronic
979594221 4:122515516-122515538 AGTGGGAAATGGAATGCTAAAGG + Intergenic
979872717 4:125845600-125845622 ATTGGCAGAAGAAACGAGAAAGG + Intergenic
980194497 4:129571094-129571116 ATTGGTAAATAGAATTACAAAGG + Intergenic
980456359 4:133048486-133048508 AGTGGCAAATTGAATGTAAATGG + Intergenic
980521041 4:133934720-133934742 TTTGGCCAATGGAATGAGGGTGG + Intergenic
982245828 4:153349479-153349501 ATTGGCAGATGGGATGAGAAAGG - Intronic
982816359 4:159890159-159890181 ATTGGAAAATTGTATTAGAAAGG + Intergenic
983726250 4:170930449-170930471 ATTTATAAAAGGAATGAGAAAGG + Intergenic
983857259 4:172661358-172661380 ATTGGCTCATGCAATGATAAAGG - Intronic
984591652 4:181624281-181624303 GCTGGCAAATGAAAAGAGAAAGG + Intergenic
986075643 5:4335182-4335204 AGTGGCCAAAGTAATGAGAAAGG + Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986488780 5:8268231-8268253 AATGGAACATGGAATGGGAATGG + Intergenic
986825063 5:11511500-11511522 AGGGGAAAATGGAATGGGAATGG - Intronic
987479412 5:18433770-18433792 GCTGGAAATTGGAATGAGAAAGG - Intergenic
987966482 5:24882859-24882881 ATTGACAATTGGAATTATAATGG - Intergenic
988372655 5:30391547-30391569 CTTGCCAAATGGAATGAGGCAGG - Intergenic
988729330 5:33954732-33954754 AAGGGCAAAGGGAATGAGAATGG + Intronic
989252044 5:39328588-39328610 ATTGGCAAATGTAGTCAAAATGG + Intronic
989661348 5:43801658-43801680 TCTGGCAAATGGACTGTGAATGG - Intergenic
990512254 5:56499432-56499454 ATTGGCCAATGGGATGCAAAGGG - Intergenic
990670561 5:58124915-58124937 ATTGCAAAATGGAATGGGGAGGG + Intergenic
990820228 5:59831080-59831102 TTTCTGAAATGGAATGAGAAAGG + Intronic
990907775 5:60822201-60822223 ATAGTCAAATGCACTGAGAAAGG + Intronic
991986799 5:72296642-72296664 ATTGGCATATTGGAGGAGAATGG - Intronic
992069667 5:73137053-73137075 ATAGGCAGAAGGAAGGAGAAAGG + Intergenic
993421582 5:87708359-87708381 ATTTCCAAATGGAGTGAGCAAGG - Intergenic
993668710 5:90733228-90733250 CTTGGCAACTGGGAGGAGAATGG + Intronic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
995873084 5:116762797-116762819 ATTGGGAAGAGGACTGAGAAAGG + Intergenic
996457111 5:123697189-123697211 ATGGGCAAAGAGAAAGAGAATGG + Intergenic
996753868 5:126916146-126916168 AGTGGCCAATGGAAAGAGGATGG + Intronic
997011929 5:129888608-129888630 ATTGGTAAATGTAAGTAGAAGGG + Intergenic
997079869 5:130725625-130725647 ATTGGCAAAGTGAAAAAGAATGG + Intergenic
997177217 5:131791778-131791800 ATTGGAATATGGACTAAGAATGG + Intronic
997824899 5:137097744-137097766 GTTGGCAAAATGAATGAAAACGG + Intronic
998182451 5:139954988-139955010 GTTGGCAAATGCAAGAAGAAGGG - Intronic
998279451 5:140791247-140791269 TTTGGCCAATGAAATGTGAATGG + Intronic
998539013 5:142961629-142961651 TTTGGCAACTGGGATAAGAATGG + Intronic
998770773 5:145542287-145542309 AATAGCAAATAGAAAGAGAAGGG + Intronic
998922583 5:147085816-147085838 ATTTGCAATAGGAATGAGGAAGG + Intergenic
999009334 5:148017844-148017866 ATTTGCTAATAGCATGAGAAAGG - Intergenic
1000243188 5:159427479-159427501 ATTCTCAAAGGGAATCAGAAGGG - Intergenic
1001832502 5:174801227-174801249 AGAGGCAAAGGGACTGAGAAAGG - Intergenic
1003965588 6:11249525-11249547 TCTGGCTAATGGGATGAGAATGG - Intronic
1004100684 6:12607284-12607306 ATTGGGAAATTGAATGGGGATGG - Intergenic
1004991883 6:21147382-21147404 ATTGGCAAATAGAATATGATGGG + Intronic
1005173369 6:23014080-23014102 ATTTGCAAATGAACTGACAATGG + Intergenic
1005190541 6:23216777-23216799 ATGGGAAAATAGAATGAAAAAGG + Intergenic
1005431017 6:25757036-25757058 ATTGGCAAATGGAATGGTTCTGG - Intronic
1007948722 6:45850363-45850385 ATTGGAAACAGGAATGAGTAAGG - Intergenic
1008113818 6:47523308-47523330 ATTGGGAATTGTAATGAAAATGG + Intronic
1008669831 6:53756113-53756135 ATTGGCAGATGTAAAGAAAATGG - Intergenic
1009193718 6:60660353-60660375 ATGGCCTCATGGAATGAGAAAGG + Intergenic
1009555201 6:65154973-65154995 ATTGACAAATGGGTTTAGAAAGG + Intronic
1009585670 6:65598569-65598591 GTTGGCAAATGGAGTAAAAAAGG - Intronic
1010663243 6:78596157-78596179 ATTAGAAAAGGGAATGAAAAAGG + Intergenic
1010785801 6:79999662-79999684 TTTGGCAAATAAAATGATAAAGG - Intergenic
1012013622 6:93826038-93826060 GTAGGCAAATGTAATTAGAAGGG + Intergenic
1012065820 6:94550710-94550732 ATTGGAAAATGGAAAGTCAATGG + Intergenic
1013018196 6:106180520-106180542 CTTGGAAATTGCAATGAGAAAGG - Intergenic
1014310890 6:119799939-119799961 ATAAGCAAAGGGAATGAGAAAGG + Intergenic
1014475776 6:121870983-121871005 ATTGTTAAGTGAAATGAGAATGG - Intergenic
1014683389 6:124463575-124463597 ATTGGCAAAGGTAAAGAGATAGG - Intronic
1014684319 6:124477384-124477406 ATTGGCAACTTGTATGAGACAGG - Intronic
1014759404 6:125339624-125339646 ATTAGAAAAAGGAAAGAGAATGG + Intergenic
1016695673 6:146992125-146992147 GTTGGAGAATGGAATGAGAGAGG - Intergenic
1016916941 6:149252812-149252834 GTTGGCCAATAAAATGAGAAAGG + Intronic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1018190349 6:161304838-161304860 GATGGTAAATGGAATGAGGAAGG + Intergenic
1018426332 6:163686298-163686320 ATTGGCACATAGAAAGTGAAGGG + Intergenic
1018595246 6:165472332-165472354 ATAGGCATTAGGAATGAGAAAGG - Intronic
1020324435 7:6963413-6963435 AGTGGGAACTGGAATGAGATTGG + Intergenic
1020377558 7:7505081-7505103 ATTGGCAAATTAAAATAGAATGG - Intronic
1021039334 7:15842446-15842468 ATTGTCAAATGGAAGGGAAAAGG + Intergenic
1021391640 7:20100610-20100632 ATTAGCAAAGGTAATAAGAAAGG + Intergenic
1021899874 7:25274741-25274763 AATGGGAAATAAAATGAGAAAGG - Intergenic
1023483079 7:40655910-40655932 TTTGGCAAATATAATGAGACAGG - Intronic
1023564351 7:41508657-41508679 ACTGCAAGATGGAATGAGAAAGG + Intergenic
1023611679 7:41978184-41978206 ATAGGCGTATGGAATGGGAAGGG - Intronic
1024192157 7:47023393-47023415 ATTGGCCAATGTGATAAGAACGG + Intergenic
1024272292 7:47651519-47651541 ATTGGCCAATGGGAGGAGGAGGG - Intergenic
1026336355 7:69397283-69397305 AGTGGAGAATGGAATGAGACGGG + Intergenic
1027488591 7:78793117-78793139 AGTGGCAAAGGGAAAAAGAAAGG - Intronic
1027752785 7:82172347-82172369 AATGGCAAAAGGAATGGAAATGG + Intronic
1030359683 7:108581658-108581680 ATCAGGAAATGGAAGGAGAAAGG + Intergenic
1031674799 7:124596518-124596540 ATTGGTAAATGGAGGAAGAAAGG - Intergenic
1032000758 7:128263692-128263714 AATTGCACTTGGAATGAGAATGG + Intergenic
1032335223 7:131018599-131018621 ATTTGGAAATGGAATTGGAAAGG - Intergenic
1032577733 7:133073294-133073316 AAGGGCACATAGAATGAGAAGGG - Intronic
1033090692 7:138383065-138383087 TTTGGCAAAAGGAAGGAGGAAGG - Intergenic
1033285941 7:140040501-140040523 ATTGGCTGATGGAAGGAGGAGGG - Intronic
1035936309 8:3844616-3844638 ATCTGCAGATGGAAGGAGAACGG + Intronic
1036371627 8:8167538-8167560 AGTGGGAACTGGAATGAGATTGG - Intergenic
1036879276 8:12498106-12498128 AGTGGGAACTGGAATGAGATTGG + Intergenic
1037506759 8:19538466-19538488 ACTTGTAATTGGAATGAGAATGG + Intronic
1037515312 8:19625100-19625122 TCTGGCCAATGGAATGTGAATGG - Intronic
1037698838 8:21253351-21253373 TTTGGCCAATGGAATGTGACTGG - Intergenic
1038105604 8:24430395-24430417 ATTGTCAAATTGGAGGAGAAAGG + Intergenic
1038980932 8:32758802-32758824 ACTAGGAAATGGAAGGAGAAAGG + Intronic
1039976230 8:42367565-42367587 AAGGGGATATGGAATGAGAATGG - Intronic
1040359615 8:46652575-46652597 TTTGGCAAGTGGCATTAGAAGGG + Intergenic
1040618313 8:49062160-49062182 ATGGGCAAATGCAAACAGAACGG + Intronic
1040646822 8:49407584-49407606 ATTTGCCAATGGTATGAGGAAGG + Intergenic
1040721699 8:50331992-50332014 ATCAGCAAATGGAATCACAAAGG + Intronic
1041870211 8:62625683-62625705 ATTTGCATAAGGATTGAGAAGGG + Intronic
1043816079 8:84803173-84803195 ATTGGCAAATACAGAGAGAAGGG + Intronic
1044112473 8:88292058-88292080 ATTGTGCAATGGAATAAGAATGG - Intronic
1044949904 8:97425816-97425838 GTCTGCAAATTGAATGAGAAAGG - Intergenic
1045840371 8:106572876-106572898 ATTGGCTAATGGAATTATGAAGG + Intronic
1045916124 8:107473861-107473883 ATTTGCAAAGGGAACGGGAATGG + Intronic
1046207980 8:111028046-111028068 CTTGGCAAATGGTGTGAGATGGG - Intergenic
1046679674 8:117154747-117154769 TTTGACAAATGGTATCAGAAAGG - Intronic
1046782967 8:118235149-118235171 ATTTGTTAATGGACTGAGAATGG - Intronic
1047879685 8:129179795-129179817 ACTGATAAATGGAATCAGAAGGG - Intergenic
1047938313 8:129803140-129803162 AGTGGCAAAGAGAAGGAGAAAGG - Intergenic
1048339795 8:133529707-133529729 GTGGGCAAATGAGATGAGAAGGG - Intronic
1048412128 8:134186039-134186061 ATTATCAAATGGAATGATTAAGG - Intergenic
1050107597 9:2181944-2181966 CTTGGCAAAAGGAATGACAGTGG + Intronic
1051333300 9:16044862-16044884 ATTGGCAACAAGAAGGAGAAAGG - Intronic
1052465781 9:28828232-28828254 ATTGCCAAATGGTATGAAAAAGG - Intergenic
1052718569 9:32147473-32147495 AATGATAAATGGAATAAGAAAGG + Intergenic
1053276947 9:36790342-36790364 ATTTGGAAATGGAAGGGGAAGGG + Intergenic
1053342451 9:37349119-37349141 AATGCCAAATTGAATGAGGAGGG + Intronic
1055328470 9:75157062-75157084 ATTGGCAAGGGGGAGGAGAAGGG - Intergenic
1055720869 9:79173231-79173253 CCTAGCCAATGGAATGAGAATGG + Intergenic
1056042173 9:82679841-82679863 TTTGGCCAATGGAATGTGAGTGG - Intergenic
1056979889 9:91299997-91300019 ATTGGTAACTGGAACAAGAATGG - Intronic
1057796387 9:98160933-98160955 CTTGGCCAAAGGGATGAGAAGGG + Intronic
1057868202 9:98698201-98698223 CTTGCCAAATGGCAGGAGAAGGG + Intronic
1059188441 9:112299750-112299772 TTTGGCAAATGGAACATGAATGG + Intronic
1059571365 9:115439970-115439992 ATTGGCCAATGGAACATGAATGG + Intergenic
1059590066 9:115649298-115649320 ATTGGAAAATTAAATGAGAGCGG + Intergenic
1059980879 9:119770480-119770502 ATGGTCAAATGGAAAGATAATGG - Intergenic
1061882968 9:133577237-133577259 ATTGGGAAATGGAATCATGAGGG + Intergenic
1203693765 Un_GL000214v1:74374-74396 ATTGGCAAATGTGAGGAAAAAGG - Intergenic
1203558218 Un_KI270744v1:22746-22768 ATTGGCAAATGTGAGGAAAAAGG - Intergenic
1203642508 Un_KI270751v1:29689-29711 ATTGGCAAATGTGAGGAAAAAGG + Intergenic
1187590949 X:20716707-20716729 ATTGGTCAATAGAATGAGATAGG + Intergenic
1187779062 X:22796704-22796726 TTTGGCCAATGGAATGACAGCGG + Intergenic
1187817785 X:23251533-23251555 ATTAGCAAATGGGAAGAGAGAGG - Intergenic
1188032354 X:25278178-25278200 ATTTGCAAATAAAATGAAAAAGG - Intergenic
1188299097 X:28485342-28485364 ACTGGTAGATGGAATGAGAATGG - Intergenic
1188880408 X:35485314-35485336 ATTGGCAAGTGGAAGGTGAATGG + Intergenic
1189540360 X:41981164-41981186 TCTGGCCAATGGAATGTGAATGG - Intergenic
1190143679 X:47870972-47870994 ATGGGCAAATGGATTAAGGAAGG - Intronic
1190568092 X:51751534-51751556 ATTAGCAAATCCAGTGAGAAGGG - Intergenic
1191817625 X:65265331-65265353 ATTGGCAACTGGAGTGTGCATGG + Intergenic
1192140170 X:68640099-68640121 ATGGGAAACTAGAATGAGAAAGG - Intergenic
1194493122 X:94576280-94576302 ATTGGAGGATGGAATGAGAAAGG - Intergenic
1194794627 X:98196304-98196326 TTTTGAAGATGGAATGAGAAGGG - Intergenic
1195039412 X:101000526-101000548 AATGGCAGAAGGAATGAGAAAGG + Intergenic
1195576178 X:106453544-106453566 ATTAGCAAAGGGCATGAGATGGG + Intergenic
1195780182 X:108453910-108453932 CTTGGCAATTGGATTGAAAATGG - Intronic
1196526543 X:116734432-116734454 ATTGACAAATGGCTTGAGAAAGG - Intergenic
1197149133 X:123201110-123201132 TTTGGCAAATGTAATAATAATGG - Intronic
1197651226 X:129066964-129066986 AATGGGAAATGGAAAGAAAAAGG + Intergenic
1198039916 X:132840400-132840422 AGTGACAAAGGGAAAGAGAAAGG - Intronic
1199413780 X:147556273-147556295 ATTTGCAAATGGTATGAGACTGG - Intergenic
1200647963 Y:5809250-5809272 ATTGTCTTATGGAATGAGTAAGG + Intergenic