ID: 1117384346

View in Genome Browser
Species Human (GRCh38)
Location 14:55195633-55195655
Sequence CACAGCAGGCTGAAGTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117384346_1117384352 29 Left 1117384346 14:55195633-55195655 CCAGAGCACTTCAGCCTGCTGTG No data
Right 1117384352 14:55195685-55195707 ATTGCTAGGCTATTGCCCTCTGG No data
1117384346_1117384350 15 Left 1117384346 14:55195633-55195655 CCAGAGCACTTCAGCCTGCTGTG No data
Right 1117384350 14:55195671-55195693 AAGCTCAAGTTCCAATTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117384346 Original CRISPR CACAGCAGGCTGAAGTGCTC TGG (reversed) Intergenic
No off target data available for this crispr