ID: 1117384369

View in Genome Browser
Species Human (GRCh38)
Location 14:55195809-55195831
Sequence AGGGAGAGCGCAGTGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117384369_1117384375 14 Left 1117384369 14:55195809-55195831 CCATCAGTCACTGCGCTCTCCCT No data
Right 1117384375 14:55195846-55195868 GATTCTCTCTCCATACCACATGG No data
1117384369_1117384379 27 Left 1117384369 14:55195809-55195831 CCATCAGTCACTGCGCTCTCCCT No data
Right 1117384379 14:55195859-55195881 TACCACATGGCCACTGGTGGAGG No data
1117384369_1117384378 24 Left 1117384369 14:55195809-55195831 CCATCAGTCACTGCGCTCTCCCT No data
Right 1117384378 14:55195856-55195878 CCATACCACATGGCCACTGGTGG No data
1117384369_1117384376 21 Left 1117384369 14:55195809-55195831 CCATCAGTCACTGCGCTCTCCCT No data
Right 1117384376 14:55195853-55195875 TCTCCATACCACATGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117384369 Original CRISPR AGGGAGAGCGCAGTGACTGA TGG (reversed) Intergenic
No off target data available for this crispr