ID: 1117384378

View in Genome Browser
Species Human (GRCh38)
Location 14:55195856-55195878
Sequence CCATACCACATGGCCACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117384374_1117384378 -1 Left 1117384374 14:55195834-55195856 CCAAAGTGCACAGATTCTCTCTC 0: 35
1: 86
2: 137
3: 239
4: 558
Right 1117384378 14:55195856-55195878 CCATACCACATGGCCACTGGTGG No data
1117384373_1117384378 0 Left 1117384373 14:55195833-55195855 CCCAAAGTGCACAGATTCTCTCT 0: 14
1: 53
2: 102
3: 203
4: 464
Right 1117384378 14:55195856-55195878 CCATACCACATGGCCACTGGTGG No data
1117384370_1117384378 5 Left 1117384370 14:55195828-55195850 CCCTCCCCAAAGTGCACAGATTC 0: 11
1: 38
2: 121
3: 185
4: 491
Right 1117384378 14:55195856-55195878 CCATACCACATGGCCACTGGTGG No data
1117384371_1117384378 4 Left 1117384371 14:55195829-55195851 CCTCCCCAAAGTGCACAGATTCT 0: 13
1: 38
2: 125
3: 202
4: 596
Right 1117384378 14:55195856-55195878 CCATACCACATGGCCACTGGTGG No data
1117384369_1117384378 24 Left 1117384369 14:55195809-55195831 CCATCAGTCACTGCGCTCTCCCT No data
Right 1117384378 14:55195856-55195878 CCATACCACATGGCCACTGGTGG No data
1117384372_1117384378 1 Left 1117384372 14:55195832-55195854 CCCCAAAGTGCACAGATTCTCTC No data
Right 1117384378 14:55195856-55195878 CCATACCACATGGCCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117384378 Original CRISPR CCATACCACATGGCCACTGG TGG Intergenic
No off target data available for this crispr