ID: 1117387344

View in Genome Browser
Species Human (GRCh38)
Location 14:55229198-55229220
Sequence GAGCAGCACCAAATCCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 2, 2: 2, 3: 25, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117387340_1117387344 18 Left 1117387340 14:55229157-55229179 CCATCTCAAAAATAAAATAAAAT 0: 585
1: 568
2: 5054
3: 108578
4: 88996
Right 1117387344 14:55229198-55229220 GAGCAGCACCAAATCCAAGATGG 0: 2
1: 2
2: 2
3: 25
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117387344 Original CRISPR GAGCAGCACCAAATCCAAGA TGG Intergenic
900440575 1:2653072-2653094 GAGCAGCACCAAAACCCCTAGGG + Intronic
901901107 1:12363583-12363605 GAACAGCATCAAATGAAAGAAGG - Intronic
902247439 1:15130141-15130163 GGGCAGCACCAAATCGAAGGTGG + Intergenic
902248831 1:15140099-15140121 GAGCAGCAGAAAATCCAGGCTGG + Intergenic
902979607 1:20113520-20113542 AAGCAACACCAGAACCAAGAAGG - Exonic
904286841 1:29458338-29458360 GGGCAGCACCAAGGCCAAGCGGG + Intergenic
905881023 1:41463832-41463854 AAGCACTCCCAAATCCAAGAAGG - Intergenic
906258018 1:44365522-44365544 GAGCAGCAGCAGTGCCAAGAAGG - Intergenic
907700968 1:56787894-56787916 GGACAGCTCCAAATCAAAGAAGG - Intronic
908489354 1:64627526-64627548 GAGCATCATGAACTCCAAGAAGG - Intronic
909296676 1:73958085-73958107 TATCAGCAGGAAATCCAAGAAGG + Intergenic
910844502 1:91592521-91592543 GGGCAGCACCGAATCACAGAGGG - Intergenic
913107655 1:115629389-115629411 GAGCAGCGCCAAAGCTCAGAGGG - Intergenic
913598045 1:120396379-120396401 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914089284 1:144482941-144482963 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914309327 1:146451274-146451296 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914512349 1:148345282-148345304 GGGCAGCAGCAACTCCAAGGGGG - Intergenic
914592784 1:149121863-149121885 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914940009 1:152014299-152014321 GGGCAGCAGCAACTTCAAGAGGG + Intergenic
917819192 1:178744433-178744455 GACCAGCAACAAAACAAAGATGG + Intronic
918799588 1:188955209-188955231 GAACAGCACCACAACCAAGTAGG + Intergenic
919012772 1:191986625-191986647 TAGCACCTCCAAATCCAAAAAGG - Intergenic
919193706 1:194256583-194256605 GGGCATCACCAAATCAATGAGGG + Intergenic
921860052 1:220033243-220033265 GATCAGCTCCAAAGGCAAGAAGG + Intronic
1064148812 10:12846149-12846171 CAACAGCACAAAACCCAAGAAGG - Intergenic
1064610313 10:17092547-17092569 AAACACCACCAAAACCAAGATGG + Intronic
1065721979 10:28636110-28636132 GAGCAGCACAGCATCCATGAAGG + Intergenic
1065877250 10:30008081-30008103 GAGCAGCCACAAGGCCAAGAGGG - Intergenic
1069077602 10:64054393-64054415 TACCAGCACCAAAACAAAGAAGG + Intergenic
1069492435 10:68872853-68872875 GACCAAAACCAATTCCAAGAGGG - Intronic
1070009411 10:72457563-72457585 GAGCAACACCAACACCAAGCTGG + Intronic
1072420647 10:95288624-95288646 GACCAGCACCAGATCTCAGATGG + Intronic
1072535838 10:96362139-96362161 CAGCAGCAGCAACTCCCAGACGG + Intergenic
1072591870 10:96833577-96833599 CAGCAGCACCGAAGCAAAGACGG - Intronic
1076186734 10:128456331-128456353 CAGCAGCAGCAGATCCAAGTGGG + Intergenic
1078570006 11:12449541-12449563 GAGCAGCAGTAAGTCCATGAAGG - Intronic
1081757473 11:45554779-45554801 GTGCAGTATCTAATCCAAGAGGG + Intergenic
1085346327 11:75770339-75770361 GAGCAGCACCCACACCAAGAGGG - Intronic
1085358440 11:75862469-75862491 GACAAGGGCCAAATCCAAGATGG - Intronic
1085649596 11:78255651-78255673 AAACAGCACCAAACCCAAGTTGG - Intronic
1089978415 11:122752562-122752584 ATGCAGCAGCAAATACAAGAAGG + Intronic
1091367986 11:135037906-135037928 GAGAGGCACCACATCCAAGATGG - Intergenic
1093020014 12:14194680-14194702 GAGAAGCTCCAAATAAAAGAGGG + Intergenic
1093474878 12:19543819-19543841 GAACAGAAACAAATCCAATATGG - Intronic
1093554107 12:20450088-20450110 GAGCAGCATCAAATCCAAGACGG - Intronic
1094440450 12:30470393-30470415 AAGCTGCAACAAATTCAAGAAGG - Intergenic
1094836024 12:34322471-34322493 AAGCAGCAAGAAATCCAAGAAGG - Intergenic
1097036699 12:56129037-56129059 GAGTGGCACCAAAAGCAAGAGGG - Intronic
1097734893 12:63171481-63171503 TAGCCACACCTAATCCAAGAAGG + Intergenic
1098080293 12:66777298-66777320 GGGCAGCACCAAGACCAAGTTGG - Intronic
1099094258 12:78353473-78353495 GTGCAGCATAAAATCAAAGAAGG + Intergenic
1099286442 12:80718139-80718161 GAGCAGCAGCAAAGGGAAGAGGG - Intronic
1100493118 12:95100002-95100024 GACCAGAAGCAAATCCCAGATGG - Intronic
1101040906 12:100754492-100754514 GAGGACCACCAAGTCCATGATGG - Intronic
1101627562 12:106460546-106460568 GAGGAGCACCAAAGAGAAGATGG + Intronic
1101864455 12:108510189-108510211 CAGCAGCACCAAATTCAACATGG + Intergenic
1104640492 12:130463879-130463901 GAGACCCACCAAAACCAAGATGG + Intronic
1105470657 13:20691798-20691820 GAGCAGTAACAACTCTAAGATGG + Intergenic
1106513030 13:30427972-30427994 AAGCAGCACCAAATCCAAGATGG + Intergenic
1107870097 13:44738576-44738598 GAGGACCACCAAATGCAAGGTGG - Intergenic
1114513578 14:23282520-23282542 GAACACCACCAAATCCAAGCTGG + Intronic
1117387344 14:55229198-55229220 GAGCAGCACCAAATCCAAGATGG + Intergenic
1118029263 14:61804271-61804293 GATCACCACCAAATACAACAAGG - Intergenic
1119605611 14:76013658-76013680 GAGCAGCAACAAATCCAAAATGG + Intronic
1119715684 14:76857436-76857458 GAGGAACCCCAAATCCAGGATGG + Exonic
1119912402 14:78361762-78361784 GAGCTGTACCAAATCCAGGAAGG - Intronic
1120234438 14:81874871-81874893 GAGAAGCCCCACAGCCAAGACGG + Intergenic
1121336822 14:93082711-93082733 GAGCAGGACCCAAGCCAAGCCGG + Intronic
1124095474 15:26644801-26644823 GAGCAGAAGCAAGTCCAAGGTGG + Intronic
1124239220 15:28016235-28016257 GAGCAGTGCCAGATCCCAGATGG - Intronic
1126394269 15:48196215-48196237 GAGATGCACCAAATCCAAACAGG - Intronic
1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG + Intergenic
1129918159 15:79293464-79293486 AAGCATCAGCAAGTCCAAGATGG + Exonic
1132051510 15:98611361-98611383 GAGAAGCATAAAGTCCAAGAGGG - Intergenic
1138453859 16:57109725-57109747 AGCCAGCACCAAAACCAAGACGG - Intronic
1138741227 16:59312984-59313006 AAGATGCAACAAATCCAAGAGGG + Intergenic
1139004842 16:62558221-62558243 CAGCAGTACCAAGTCCAGGAAGG + Intergenic
1141386708 16:83628055-83628077 GAAAAACACCAAAACCAAGATGG - Intronic
1145028871 17:19489546-19489568 GAGCAGCACCAAACCCCTGCTGG + Intergenic
1147646980 17:42039909-42039931 GGGCAGCGCCAAAGCCAAGGCGG + Intronic
1150611199 17:66734550-66734572 AAAACGCACCAAATCCAAGATGG - Intronic
1152798549 17:82320587-82320609 GACCAGCACTAAATCCCAGTAGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1165146098 19:33731505-33731527 AAACCTCACCAAATCCAAGATGG - Intronic
1165182765 19:33987026-33987048 GAGCAGCAGCAAATCCATACAGG - Intergenic
1165810149 19:38607171-38607193 GAGCAGCAGCACATTCTAGAAGG + Intronic
1167026048 19:46919111-46919133 GAGCAGAAACAAATGCCAGACGG + Exonic
1167720611 19:51177686-51177708 CAGCAGCACCCAAACCATGACGG + Intergenic
925466755 2:4112807-4112829 GAGCACCACCATAACCCAGAAGG + Intergenic
925675450 2:6356976-6356998 GAGCCGCTCTAGATCCAAGAAGG - Intergenic
929273385 2:39999102-39999124 GAGCAGAACAAATCCCAAGATGG - Intergenic
932005598 2:67924067-67924089 TAGCAGCAGCAAATCCATAAGGG - Intergenic
933517228 2:83320156-83320178 GAGCAACACAAAGTCCAAGAAGG + Intergenic
934985879 2:98884199-98884221 CAGCAGCACTGAGTCCAAGAGGG + Intronic
935208238 2:100915214-100915236 GAGCAGCTACACTTCCAAGAGGG + Intronic
935343000 2:102074585-102074607 CAGAAGCACCAAATTCAAGCTGG + Intronic
936290886 2:111223112-111223134 CACCACCACCAAATCCAAGCTGG - Intergenic
939308721 2:140444044-140444066 GAGAAGCACCAAATAAAACATGG - Intronic
940241664 2:151569914-151569936 CAAAATCACCAAATCCAAGAAGG - Intronic
940928172 2:159392179-159392201 AAGCAACAACAAAGCCAAGACGG + Intronic
942309860 2:174646028-174646050 AAGGAGCACCAAATGTAAGATGG - Intronic
942485312 2:176433225-176433247 GAGCAACACCAAATTCTAGAAGG - Intergenic
944291536 2:198012421-198012443 GTGCAGAACGAATTCCAAGATGG - Intronic
944934242 2:204551078-204551100 TAGCAGAACCAAAACCAAGTTGG - Intronic
946275807 2:218630759-218630781 GGGCAGCACCCCATCCAAGGTGG - Exonic
947332733 2:229047141-229047163 GAGCAGCATCACATCCATGAGGG + Intronic
947546623 2:231015051-231015073 GAGCACCAGCAAATCCTACAGGG + Intronic
1169908265 20:10625006-10625028 GAGCAGGAAAAAAGCCAAGAGGG - Exonic
1171390058 20:24795483-24795505 GACCAGCACCCACTCCAACATGG - Intergenic
1172405905 20:34688897-34688919 CAGCAGCTTCAAATCCAAAACGG - Intergenic
1174690541 20:52499882-52499904 GACAATCACCAAATCTAAGAGGG + Intergenic
1175090668 20:56500869-56500891 GAGGATCACCAAATCCCAGGAGG - Intronic
1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG + Intronic
1178925182 21:36768826-36768848 GACCAGCAGAAAATCTAAGAAGG + Intronic
1179276480 21:39896383-39896405 GAGTTGGACCAAATCCGAGATGG - Intronic
1179804729 21:43829999-43830021 AAGCAGCACCAAATCCGAGATGG - Intergenic
1180236437 21:46462290-46462312 AAGCATCTCCAAATCCAACAGGG - Intronic
1181256731 22:21567726-21567748 GAGCAGCACCAAATCCAAGATGG + Intronic
1182368085 22:29792124-29792146 TAGCAGCACCATACCCAGGATGG - Intronic
1185227888 22:49663598-49663620 GAGCAGCTCCAAGTGCAGGAGGG + Intergenic
949730631 3:7108532-7108554 GAGCAGCAGAAAACTCAAGAGGG - Intronic
950553949 3:13684165-13684187 GAGCTGCTCCAAACCCACGAAGG + Intergenic
953433288 3:42857109-42857131 GAGAGGCACCAAATTCAAGACGG - Intronic
954700515 3:52448320-52448342 GAGCAGGAACCAATCCAAGATGG - Intergenic
954813094 3:53259999-53260021 GGGCTGCACCCAAGCCAAGAGGG + Intergenic
955357378 3:58242243-58242265 GGGCAGCACCAAATCCTAAGTGG + Intronic
955605090 3:60693199-60693221 GATCAGCACCTTATCCAAGAAGG - Intronic
956787646 3:72655840-72655862 CAGGAGCACCAATGCCAAGAGGG - Intergenic
956858937 3:73303391-73303413 CAGTAGCCACAAATCCAAGAAGG - Intergenic
962647014 3:137450260-137450282 GACCAGGGCCAAATCCAAAATGG - Intergenic
965926739 3:173989820-173989842 GAACAGCACACAAACCAAGAAGG + Intronic
969043171 4:4317132-4317154 GAGCAGCAGCAAGTCCTAGCTGG - Intronic
980280840 4:130717332-130717354 CAGCAGCAGCCAATCAAAGAAGG + Intergenic
981183263 4:141770196-141770218 GAGCATCATCAAATGAAAGAAGG - Intergenic
982863924 4:160487367-160487389 GAAAACCACCAAAACCAAGATGG + Intergenic
983274144 4:165597123-165597145 CAGCAGCCCCACATCCAGGAAGG - Intergenic
984122059 4:175757780-175757802 GAGCAGCCCTGTATCCAAGAAGG + Intronic
986831832 5:11588922-11588944 GAGCAGCTCAAAAACCGAGAAGG + Intronic
994587225 5:101724012-101724034 GAGCAGGAGAAAATCCAAGCTGG - Intergenic
998548938 5:143057908-143057930 GAACAGCAGCAAATGCCAGATGG + Intronic
1001622317 5:173098020-173098042 AAGCAAAAGCAAATCCAAGAGGG - Intronic
1005449099 6:25955700-25955722 AAACCCCACCAAATCCAAGATGG + Intergenic
1005449108 6:25955753-25955775 GCTCCCCACCAAATCCAAGATGG + Intergenic
1005810730 6:29513810-29513832 GAGCAGGCCCTAATCCAATACGG + Intergenic
1006764728 6:36494842-36494864 GAACAGCACCTTAGCCAAGAGGG + Exonic
1008224453 6:48896843-48896865 GAGCAGAAGTAAATCCAAGCAGG - Intergenic
1008369882 6:50720051-50720073 GAGCAGCACACAAGGCAAGAGGG + Intronic
1010234596 6:73564826-73564848 AAGAAGCATCAAAACCAAGATGG + Intergenic
1013383022 6:109596303-109596325 CACCAGCACCAGCTCCAAGAGGG + Intronic
1013606672 6:111756492-111756514 TCTCAGAACCAAATCCAAGATGG + Intronic
1017085863 6:150712203-150712225 GAGCTGCCCCAAATCAATGAGGG + Intronic
1018002338 6:159590665-159590687 CAGCAGCCCCTAACCCAAGATGG - Intergenic
1019546089 7:1577156-1577178 GAAACCCACCAAATCCAAGATGG - Intergenic
1020325888 7:6975053-6975075 GACCAGCACCCCATCCAGGAGGG - Intergenic
1021301189 7:18975018-18975040 GAGTAGCCCCAAATCAAAGCAGG - Intronic
1022326529 7:29337051-29337073 AAGCAGCACCCAATCCTAGAGGG - Intronic
1023054519 7:36280735-36280757 GATCAGCGTCAAATCCAAAAAGG - Intronic
1025999229 7:66548471-66548493 CAGCAGCACCACATCTCAGAGGG + Intergenic
1026760621 7:73123244-73123266 GAGCAGAAGCAAATGCATGAAGG + Intergenic
1027036965 7:74932065-74932087 GAGCAGAAGCAAATGCATGAAGG + Intergenic
1027086599 7:75269394-75269416 GAGCAGAAGCAAATGCATGAAGG - Intergenic
1027560445 7:79721986-79722008 GAGCTGAACCAGATGCAAGAAGG - Intergenic
1028262838 7:88685988-88686010 GAGCAGCACAAAAGCCAGGCTGG + Intergenic
1029304356 7:99607682-99607704 ATGCAGCACCAAAGCCAGGAAGG - Exonic
1029392899 7:100287397-100287419 GAGCAGAAGCAAATGCATGAAGG - Intergenic
1032470869 7:132178060-132178082 CAGCTGCACTAAATCCAAGAAGG - Intronic
1033593988 7:142841322-142841344 GAGGAGCTCCAAATGCCAGAAGG - Intergenic
1035704923 8:1668414-1668436 GAGCAGCACCGAATCCACCCAGG + Exonic
1036127094 8:6072833-6072855 CTGCAGCATCAAAACCAAGAAGG - Intergenic
1036288034 8:7462098-7462120 GACCAGCTTCAAATCCAAAAGGG - Intronic
1036333442 8:7849430-7849452 GACCAGCTTCAAATCCAAAAGGG + Intronic
1042420187 8:68579436-68579458 GGGGAGCAGCAAAGCCAAGAGGG - Intronic
1043060353 8:75492650-75492672 GAGAAGAACCAAAGCCTAGAGGG + Intronic
1045572507 8:103383379-103383401 GATCAGAAAAAAATCCAAGAAGG + Intergenic
1047540097 8:125756304-125756326 GAAAAACACCAAAACCAAGATGG - Intergenic
1048197795 8:132346845-132346867 GAGCTGCCCCAAATACAAAACGG + Intronic
1049184282 8:141241231-141241253 GAGCAGCAGCACAGCCAAGAAGG + Intronic
1049532455 8:143161057-143161079 GAGCAGGACCAAAGGCACGATGG - Intergenic
1050879355 9:10679830-10679852 CAGCAGCACAAATTCAAAGATGG - Intergenic
1051153763 9:14116518-14116540 GAGCAGCAGCATTTCAAAGAAGG + Intronic
1052005376 9:23341599-23341621 GAGCAGCAACAAATACAACTAGG + Intergenic
1052409807 9:28108513-28108535 GAGTAACATCAAATCCAAGAAGG + Intronic
1054720425 9:68598039-68598061 GATAGACACCAAATCCAAGATGG - Intergenic
1055076853 9:72224469-72224491 GGGCACCACAAAATCTAAGAGGG - Intronic
1055203403 9:73695832-73695854 GAGCAGCAGCAAGAGCAAGAGGG - Intergenic
1056303856 9:85270077-85270099 GACAAGAAACAAATCCAAGAAGG + Intergenic
1056445497 9:86662366-86662388 GATCAGCTCCAAAGCCAATAGGG - Intergenic
1056446627 9:86672791-86672813 GAGAACCACCACCTCCAAGAAGG - Intergenic
1058272156 9:102986134-102986156 AAGCAGCACCAATTCTAATAGGG - Intergenic
1058812751 9:108657065-108657087 GAGCAGCAGGAATTCCAAAAAGG + Intergenic
1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG + Intronic
1059626205 9:116069251-116069273 CAGAAGCACCAAATCCCAAATGG - Intergenic
1061393069 9:130328278-130328300 GAGCTGCAGCAATGCCAAGAGGG - Intronic
1186591447 X:10934183-10934205 GAGCAGAACAAAAACCAAGATGG - Intergenic
1186962028 X:14746887-14746909 TAGCAGCACCAAATTTACGATGG + Intergenic
1187336962 X:18389745-18389767 GAGCAGCACAAAATCCAGGCAGG - Intergenic
1187819897 X:23276333-23276355 GTGCGGCAAGAAATCCAAGAAGG + Intergenic
1190387385 X:49895942-49895964 GAGAATCACCAAATCCCAGGAGG - Intergenic
1196134518 X:112193559-112193581 AAGCAGAACCAAGTCCAAGAAGG - Intergenic
1196362979 X:114888364-114888386 CAGCAGCACCATACCCAAGCTGG + Intronic
1198228070 X:134664736-134664758 GAGAAGCACTATTTCCAAGAAGG + Intronic
1198234952 X:134728286-134728308 AAGCACCACCAACTCCAAGTAGG + Intronic
1200355535 X:155546279-155546301 CAGCATCACCAACTCCAAGCAGG - Intronic