ID: 1117387524 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:55230959-55230981 |
Sequence | AAGAACCTGGGGTAGGTATC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1117387519_1117387524 | 11 | Left | 1117387519 | 14:55230925-55230947 | CCAGTGTTCAAGAGTTTCTCTAA | No data | ||
Right | 1117387524 | 14:55230959-55230981 | AAGAACCTGGGGTAGGTATCTGG | No data | ||||
1117387518_1117387524 | 24 | Left | 1117387518 | 14:55230912-55230934 | CCTGTTATGGAAACCAGTGTTCA | No data | ||
Right | 1117387524 | 14:55230959-55230981 | AAGAACCTGGGGTAGGTATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1117387524 | Original CRISPR | AAGAACCTGGGGTAGGTATC TGG | Intergenic | ||
No off target data available for this crispr |