ID: 1117387524

View in Genome Browser
Species Human (GRCh38)
Location 14:55230959-55230981
Sequence AAGAACCTGGGGTAGGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117387519_1117387524 11 Left 1117387519 14:55230925-55230947 CCAGTGTTCAAGAGTTTCTCTAA No data
Right 1117387524 14:55230959-55230981 AAGAACCTGGGGTAGGTATCTGG No data
1117387518_1117387524 24 Left 1117387518 14:55230912-55230934 CCTGTTATGGAAACCAGTGTTCA No data
Right 1117387524 14:55230959-55230981 AAGAACCTGGGGTAGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117387524 Original CRISPR AAGAACCTGGGGTAGGTATC TGG Intergenic
No off target data available for this crispr