ID: 1117389229

View in Genome Browser
Species Human (GRCh38)
Location 14:55247356-55247378
Sequence TGGTTTTTCCAGATGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117389229_1117389240 19 Left 1117389229 14:55247356-55247378 CCCAACCCCATCTGGAAAAACCA No data
Right 1117389240 14:55247398-55247420 CAGTCAGCACCAGGAGTAGTGGG No data
1117389229_1117389238 10 Left 1117389229 14:55247356-55247378 CCCAACCCCATCTGGAAAAACCA No data
Right 1117389238 14:55247389-55247411 AAAGACTGACAGTCAGCACCAGG No data
1117389229_1117389241 26 Left 1117389229 14:55247356-55247378 CCCAACCCCATCTGGAAAAACCA No data
Right 1117389241 14:55247405-55247427 CACCAGGAGTAGTGGGTCCCTGG No data
1117389229_1117389239 18 Left 1117389229 14:55247356-55247378 CCCAACCCCATCTGGAAAAACCA No data
Right 1117389239 14:55247397-55247419 ACAGTCAGCACCAGGAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117389229 Original CRISPR TGGTTTTTCCAGATGGGGTT GGG (reversed) Intergenic
No off target data available for this crispr