ID: 1117389325

View in Genome Browser
Species Human (GRCh38)
Location 14:55247999-55248021
Sequence CTGTGGCCATAGAGGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117389316_1117389325 26 Left 1117389316 14:55247950-55247972 CCAGAGACTGGGCAGCTACAGCT No data
Right 1117389325 14:55247999-55248021 CTGTGGCCATAGAGGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117389325 Original CRISPR CTGTGGCCATAGAGGGTGGT AGG Intergenic
No off target data available for this crispr