ID: 1117399545

View in Genome Browser
Species Human (GRCh38)
Location 14:55346081-55346103
Sequence ATCTGATGCTACATGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117399545 Original CRISPR ATCTGATGCTACATGTTTTA TGG Intronic
905032089 1:34891841-34891863 ATCAGAGGCCACATGTTGTAGGG + Intronic
906653633 1:47532667-47532689 AACTGATCCTACATGTTTGCCGG - Intergenic
907930709 1:58997307-58997329 AGCTGATGCTTCAAGTTTGAAGG + Intergenic
909953899 1:81753915-81753937 ATATGATGGTGCATGTTTTGGGG + Intronic
910294439 1:85630092-85630114 AACTGAAGCTACATATTTCATGG + Intergenic
913268115 1:117065177-117065199 AGCTGATTCTACATTTTATATGG - Intronic
916536663 1:165709735-165709757 ATCTCCTCCTACATGTTTTGAGG - Intergenic
917290000 1:173462113-173462135 ATCTGCTGATACATATCTTAGGG - Intergenic
921786541 1:219237758-219237780 ACCTTATGCTTCCTGTTTTATGG + Intergenic
1063248886 10:4252472-4252494 ATCTTATGCTACAAGGTCTATGG - Intergenic
1066333621 10:34452838-34452860 AGCTAATTCTAAATGTTTTAGGG - Intronic
1067091755 10:43270025-43270047 ATCTGTTGATACATTCTTTATGG + Intergenic
1068010401 10:51442560-51442582 ATCTGAAGATACATTTTTAATGG + Intronic
1070189918 10:74102728-74102750 ATTTTATGTTCCATGTTTTATGG - Intronic
1070948343 10:80411263-80411285 ATCTGAAGCCAAATGTCTTAAGG - Intronic
1071229960 10:83574284-83574306 AACTGATAATACATCTTTTAGGG - Intergenic
1071350487 10:84736820-84736842 ATTTGTTGTTGCATGTTTTATGG + Intergenic
1071445508 10:85742798-85742820 ATCTGATGCTGTATGTCTTTGGG + Intronic
1074860912 10:117509809-117509831 TTCTGGTGCTCCATGTTTTGTGG + Intergenic
1075957544 10:126536845-126536867 CTCAGAAGCTTCATGTTTTAGGG - Intronic
1077811959 11:5647151-5647173 ATCTGAGGTTCCATGTTTTTTGG + Intergenic
1079482929 11:20901592-20901614 AGCTGATGCTAAAATTTTTAGGG + Intronic
1079513806 11:21242784-21242806 CTCTGATGCTGCCAGTTTTAAGG + Intronic
1079771864 11:24472533-24472555 ATCTAAAGGTACATGTTTTAAGG + Intergenic
1081245344 11:40759405-40759427 ATTTGATGTCACATGGTTTAGGG - Intronic
1081955778 11:47091469-47091491 ATCTCAGTCTACGTGTTTTATGG + Intronic
1083112952 11:60429887-60429909 ATCTGTTGGCACATGTTTGAAGG + Intronic
1087319440 11:96639982-96640004 ATCTGTTCATTCATGTTTTAAGG + Intergenic
1087321857 11:96671313-96671335 ATGTATTGATACATGTTTTATGG + Intergenic
1087677758 11:101182130-101182152 ATGTGATGCTTCAGGTTTCAAGG - Intergenic
1088639237 11:111855149-111855171 ATCTGACGGTATATATTTTAGGG + Intronic
1088959225 11:114644724-114644746 AGCTGATTCTAAATGTTATATGG + Intergenic
1091851354 12:3699941-3699963 CTCTGATACTACATCTTTTCTGG - Intronic
1093687669 12:22075880-22075902 ACCTGATGCTAGAGGCTTTAAGG - Intronic
1094522481 12:31207437-31207459 GTTTGAATCTACATGTTTTAGGG - Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1097305542 12:58064834-58064856 TTCTTATGCTACATGAGTTATGG + Intergenic
1100095163 12:91024951-91024973 ATATGAGGCTACATTTTTAAAGG - Intergenic
1101764468 12:107685356-107685378 TTTTGGTGCTAAATGTTTTAAGG + Intergenic
1103886059 12:124201342-124201364 ATCTAAGACTACATGTTATATGG - Intronic
1106119606 13:26848861-26848883 ATCTATTGCAACTTGTTTTATGG - Intergenic
1108448130 13:50529465-50529487 AACTGGTGCTCCATGTTGTAAGG + Intronic
1109126058 13:58518542-58518564 ATCTCATGCTAAATCTTTAATGG + Intergenic
1109932905 13:69240047-69240069 ATCTGACACAACTTGTTTTAAGG - Intergenic
1110031745 13:70624110-70624132 ATCTGATTCAACATGTGATAGGG - Intergenic
1110037657 13:70708814-70708836 AGCTGTTGCTTCATGTTGTAAGG + Intergenic
1110076743 13:71255245-71255267 ATTTCATCCTACAAGTTTTAGGG - Intergenic
1110426678 13:75375110-75375132 ATCTGAAGCCACAAGTATTAAGG + Intronic
1110644633 13:77868103-77868125 GTCTGAGGCTTCATGTTGTAGGG + Intergenic
1110697691 13:78510814-78510836 ATCTGATGCAAGATGCTTTGTGG - Intergenic
1110767470 13:79297372-79297394 ATATTATGCTACTTGTTTTTAGG + Intergenic
1111323391 13:86659959-86659981 ATCTGATGTTTCTTATTTTATGG + Intergenic
1115133517 14:30081882-30081904 ATCTGATTCTACATTTCTCATGG - Intronic
1116093900 14:40342841-40342863 ATCTGATGATATATTTTCTAGGG + Intergenic
1116260334 14:42616444-42616466 ATTTGATGTTTCATTTTTTATGG + Intergenic
1117399545 14:55346081-55346103 ATCTGATGCTACATGTTTTATGG + Intronic
1119500006 14:75117428-75117450 ATCTGCTGATGAATGTTTTATGG - Intronic
1120895092 14:89523447-89523469 ATTTATTGATACATGTTTTATGG - Intronic
1124021397 15:25928157-25928179 ATCTGATGTTACAAACTTTAGGG + Intergenic
1129736520 15:77968672-77968694 ATCCCATGCTACTTTTTTTATGG + Intergenic
1129849565 15:78784992-78785014 ATCCCATGCTACTTTTTTTATGG - Intronic
1132241886 15:100264329-100264351 TTCTGATGCTGAATATTTTAAGG - Intronic
1133415234 16:5601439-5601461 ATCTGAGGCTACATCATCTAAGG - Intergenic
1138777342 16:59739604-59739626 ATTTGATAATACATATTTTAAGG - Intronic
1147177880 17:38667905-38667927 ATCTCTTGCTTCATTTTTTAAGG - Intergenic
1149123088 17:53193712-53193734 ATCTGATTTGACATGGTTTATGG - Intergenic
1150992467 17:70275610-70275632 TTAAGATGCTCCATGTTTTATGG + Intergenic
1151875812 17:76867823-76867845 ATGAGATCCTACATGCTTTAGGG + Intergenic
1152614762 17:81332937-81332959 ATTTGATGCTACAGTATTTAGGG - Intergenic
1156218637 18:35028285-35028307 ATCTTATTATACCTGTTTTATGG + Intronic
1156531271 18:37818703-37818725 ATTTTATGCTTTATGTTTTATGG - Intergenic
1158684963 18:59605235-59605257 ATCTTCTACAACATGTTTTAGGG + Intronic
1158915583 18:62123999-62124021 ATATGATGCTTCATGCATTAGGG - Intronic
1159275344 18:66212628-66212650 ATGTGATGCTACATTTTTATCGG + Intergenic
1159546521 18:69845762-69845784 ATCTGTTGCTTTATGTCTTAAGG + Exonic
1160269883 18:77373760-77373782 ATCTGATGAAATATGTTTTAGGG - Intergenic
1162850208 19:13425340-13425362 AACTGCTGCTTCAAGTTTTATGG + Intronic
1164042186 19:21503565-21503587 AGCTGATGATACATGTCTGAAGG + Intronic
1164057832 19:21637121-21637143 AGCTGATGATACATGTCTGAAGG + Intergenic
1164307974 19:24021754-24021776 AGCTGATGATACATGTCTGAAGG - Intergenic
1164680057 19:30128276-30128298 CTCTGATGCTGAAGGTTTTACGG - Intergenic
1165723380 19:38095558-38095580 AGCTGATGCCAGATGTTTTCAGG + Intronic
930394897 2:50809375-50809397 ATATGATGCTAAATCTTTAAAGG - Intronic
930457052 2:51618411-51618433 ATCTGATGCTAATTTTTTGAAGG - Intergenic
932941353 2:76170621-76170643 TTCTGATGCTACTGATTTTAGGG - Intergenic
933116720 2:78482740-78482762 CTCTGTGGCTAGATGTTTTATGG + Intergenic
934980969 2:98840389-98840411 ATCTGTTGATACTTGCTTTATGG + Intronic
936952076 2:117987720-117987742 ATCTCAGACTACATTTTTTAAGG - Intronic
939160134 2:138577953-138577975 ATTTGTTGATACTTGTTTTATGG + Intergenic
939261996 2:139822223-139822245 ATCAGATGGTCCATATTTTATGG - Intergenic
940135348 2:150429528-150429550 ATCAGATACTACATCTGTTATGG + Intergenic
941400217 2:165021363-165021385 ATATCAGACTACATGTTTTAGGG - Intergenic
941611708 2:167669080-167669102 ATTAGAAGCTACATGTTTTGCGG - Intergenic
942433707 2:175946545-175946567 ATCTTATGCTGCATTTTTGAAGG + Intronic
942604120 2:177672493-177672515 AGCTGATGACACATATTTTAGGG - Intronic
943161812 2:184263755-184263777 ATGTGATTTTACATGTTTCACGG - Intergenic
943467131 2:188241606-188241628 GTCTGATGCAACTTGTTTTGTGG - Intergenic
948241571 2:236441563-236441585 ATCTGAGGCCCTATGTTTTATGG + Intronic
948484204 2:238270195-238270217 ATTTCATGCTACATATTTTTGGG + Intronic
1170260130 20:14396119-14396141 ATCTATTGAGACATGTTTTATGG + Intronic
1174521829 20:51137393-51137415 ATCTTATGGTTCTTGTTTTATGG + Intergenic
1174849008 20:53973613-53973635 AACAGATGCTACAGATTTTACGG + Intronic
1179287826 21:39993285-39993307 ATCTGAAGCAACATGATTTTTGG - Intergenic
949572805 3:5309910-5309932 ATCTGATGCTATACCTTTTTGGG - Intergenic
951131605 3:19052710-19052732 AACTGATGGTTCAAGTTTTAGGG - Intergenic
952212798 3:31246306-31246328 GTCTGATGCTACAATTTTTTAGG - Intergenic
955522062 3:59784614-59784636 ATGTGATTCAACATTTTTTAAGG - Intronic
955934026 3:64085298-64085320 ATCTTATGCTGCATATTTTCAGG + Intergenic
956781962 3:72610844-72610866 ACCTGAAGCTGCATGTTTTCAGG - Intergenic
957275642 3:78087962-78087984 CTCTGATTTTACATGTTTTAGGG + Intergenic
957533581 3:81472261-81472283 AAGTCAGGCTACATGTTTTAAGG + Intergenic
959956527 3:112244688-112244710 ATCTGAGGCTACACATTTTTGGG + Intronic
960656786 3:120013331-120013353 ATTTGATGTTTCTTGTTTTAAGG + Intronic
963765557 3:149332291-149332313 ATCTATTTCTACATCTTTTAGGG - Intronic
964232664 3:154488478-154488500 ATCTGATGCTATGTGTCTTGGGG - Intergenic
966323142 3:178723217-178723239 ATCTGATTCTATATTTTATACGG - Intronic
970787462 4:19816264-19816286 ATCTGCTTCTACATTTTTTCAGG - Intergenic
971935454 4:33141875-33141897 ATATGACGGTTCATGTTTTATGG + Intergenic
973629724 4:52808889-52808911 AGCTGATGCTAAATTTTATATGG + Intergenic
974282242 4:59811995-59812017 ATGTGATGATACATTTTTCATGG - Intergenic
974518521 4:62948496-62948518 ATGTATTGCTACATGGTTTAAGG - Intergenic
975189923 4:71448493-71448515 ATCAGAAAGTACATGTTTTATGG + Intronic
976294964 4:83461164-83461186 ATCTGATGTTACAAACTTTAGGG - Exonic
977363755 4:96040104-96040126 ATCTGATGCTAATTATATTATGG + Intergenic
978493855 4:109338202-109338224 ATTTGTTGATACATGTTTTATGG + Intergenic
978937735 4:114398825-114398847 CTCTGATGCTATATATTGTAAGG + Intergenic
978955213 4:114603816-114603838 AACAAATGCTACCTGTTTTATGG + Intronic
980375537 4:131942072-131942094 ATCAGTTGATACATGTTTTTAGG + Intergenic
980392170 4:132160738-132160760 AACTGATTCTAAAGGTTTTATGG - Intergenic
981771229 4:148311007-148311029 GTCTGATGCTGCAGGTTATAAGG - Intronic
983044102 4:162965711-162965733 ATCTGAAATTGCATGTTTTAAGG + Intergenic
984538875 4:181012394-181012416 CTTTGAAGCTACATCTTTTATGG - Intergenic
985813282 5:2106537-2106559 ATCTGATGCCGTATGTATTATGG - Intergenic
987277930 5:16381598-16381620 ATCTGTTGCAATATGTTTTTTGG - Intergenic
988509123 5:31851189-31851211 ATCTGATGCCTCTTATTTTAAGG - Intronic
988542877 5:32128126-32128148 AGCTAAAGCTACATGTGTTAGGG + Intronic
990393606 5:55354303-55354325 ATCTGCTGTTACTTATTTTAAGG - Intronic
991500921 5:67276646-67276668 AGCTGATTCTAAAAGTTTTATGG - Intergenic
992546289 5:77817201-77817223 AGCTAATGCTACATTTTCTAAGG - Intronic
993111903 5:83667901-83667923 ATCAGATGCTGCATGTTATGTGG + Intronic
993352854 5:86871135-86871157 ATCTGATGCGACATTATTTGAGG + Intergenic
993499082 5:88642995-88643017 TTCTGATTTTACATGTATTAAGG + Intergenic
993747493 5:91619210-91619232 AGCTGATGATATATGTTTTTGGG + Intergenic
998773901 5:145576921-145576943 ATATAATTTTACATGTTTTAGGG - Intronic
1004031752 6:11877043-11877065 ATTTGATGTTAAATGTTTCATGG + Intergenic
1004349007 6:14874807-14874829 GTCTGATGCAACTTCTTTTAGGG + Intergenic
1004657450 6:17677472-17677494 TTGTAATGCTAAATGTTTTAAGG - Intronic
1007000531 6:38308139-38308161 ATCTGATGCTTGATTCTTTAAGG - Intronic
1008196266 6:48525109-48525131 ATCTCATTCTTCATGTTTTCAGG - Intergenic
1008498210 6:52153957-52153979 ATTTGATGCTATATGAGTTAGGG - Intergenic
1011710808 6:90052078-90052100 ATCTGTTGAGACTTGTTTTAGGG + Intronic
1011943846 6:92876226-92876248 ATCTGATGATACAGCTATTATGG - Intergenic
1012130895 6:95491499-95491521 AGAAGATTCTACATGTTTTATGG - Intergenic
1012165550 6:95946210-95946232 CTGTGATTCTCCATGTTTTATGG - Intergenic
1013736707 6:113235718-113235740 ATGTGATGCCACTTATTTTAGGG - Intergenic
1014623140 6:123694130-123694152 ATGTGATGTTACATGTGTGATGG + Intergenic
1015703180 6:136058337-136058359 AGCAGATGTTACATGTTTTCAGG - Intronic
1016331486 6:142957117-142957139 ATCTGATACTGAATGTTTTATGG - Intergenic
1020106056 7:5422843-5422865 ATCCGAGGATACATGTCTTAAGG + Intronic
1021398909 7:20186461-20186483 ATATTATGCTACATTTTTTATGG - Intronic
1022067138 7:26870555-26870577 ATGAGATGCTATATATTTTAAGG - Intronic
1022154253 7:27643312-27643334 ATCTGATACTACCTGTTGAATGG + Intronic
1022943966 7:35263763-35263785 ATCTGATGCTCCTCATTTTACGG + Intergenic
1023631439 7:42168387-42168409 ATATTCTGCTACATGTTTTTTGG - Intronic
1025801766 7:64793625-64793647 AGCTGATGATACATGTCTGAAGG + Intergenic
1027608716 7:80332458-80332480 GTTTGAAGCTCCATGTTTTAGGG - Intergenic
1028184077 7:87760299-87760321 AATTGATGCTACATTGTTTAGGG + Intronic
1030563888 7:111126322-111126344 TACTAATGCTATATGTTTTATGG - Intronic
1031005228 7:116462491-116462513 ATTTGTTTCTAAATGTTTTATGG - Intronic
1033005400 7:137555868-137555890 ATATGATGCTATAGCTTTTAAGG + Intronic
1035869275 8:3119595-3119617 ATCAGATGATACCTGATTTATGG - Intronic
1036458802 8:8933729-8933751 ATCTGATGTTACAACCTTTAGGG + Intergenic
1037203649 8:16288030-16288052 ATCTTTTTCTACATGTTTTTTGG - Intronic
1037628302 8:20628134-20628156 ATCTGAGGCTGCATGCTGTAGGG - Intergenic
1038916442 8:32029430-32029452 ATGTGGTGCGAAATGTTTTATGG + Intronic
1049911986 9:277644-277666 ACCTTAAGCTACATATTTTATGG + Intronic
1053051871 9:34968677-34968699 ATCAGATAGTACATGTATTAAGG + Intronic
1058089023 9:100782917-100782939 AACTGATGCTGCCTTTTTTAAGG - Intergenic
1059870867 9:118574331-118574353 ATCTGTTGATACATATTTTATGG + Intergenic
1060801454 9:126548149-126548171 ATCTATTGCAACATGTTCTAGGG + Intergenic
1061637715 9:131924706-131924728 TTCTAATGATACAGGTTTTAGGG + Intronic
1186060385 X:5699063-5699085 TCCTGCTGCTACATGTTGTATGG + Intergenic
1186239634 X:7552582-7552604 ATTTCATTCTACATGTCTTAAGG - Intergenic
1189590017 X:42500823-42500845 ATATGATGGTACATTATTTAGGG + Intergenic
1190804950 X:53826276-53826298 ATCTGATGTTACAAACTTTAGGG - Intergenic
1192296023 X:69849030-69849052 ATATTATGCTACATGTTAAACGG - Intronic
1193526167 X:82592108-82592130 ATCTAATAGTACATATTTTAGGG + Intergenic
1194005114 X:88481994-88482016 ATATGATTCTACTTGTTTGAGGG - Intergenic
1196390257 X:115199895-115199917 ATTTGTTGATACTTGTTTTATGG - Intronic
1198610934 X:138399721-138399743 ATCTGATGCTGCATTTCTTCTGG - Intergenic
1198662074 X:138980348-138980370 GTAGGATGCTACATGTTTCAAGG - Intronic