ID: 1117400120

View in Genome Browser
Species Human (GRCh38)
Location 14:55351466-55351488
Sequence CTCCTAAGGAGGACCAGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117400113_1117400120 29 Left 1117400113 14:55351414-55351436 CCTGTGGGGTCTGTATCTGTGGA 0: 1
1: 0
2: 4
3: 42
4: 377
Right 1117400120 14:55351466-55351488 CTCCTAAGGAGGACCAGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 176
1117400116_1117400120 -1 Left 1117400116 14:55351444-55351466 CCTTCAAGAGCTGATCGTTGTTC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1117400120 14:55351466-55351488 CTCCTAAGGAGGACCAGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 176
1117400115_1117400120 0 Left 1117400115 14:55351443-55351465 CCCTTCAAGAGCTGATCGTTGTT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1117400120 14:55351466-55351488 CTCCTAAGGAGGACCAGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117400120 Original CRISPR CTCCTAAGGAGGACCAGGCC TGG Exonic
900367409 1:2316844-2316866 CTCCCAGGGAAGGCCAGGCCAGG + Intergenic
900466180 1:2826600-2826622 CCCCTCAGGAGGGCCAGGCCTGG - Intergenic
900569889 1:3353032-3353054 GCCCTGAGGAGGACCAGGCCTGG + Intronic
900880712 1:5379393-5379415 CTTGTACAGAGGACCAGGCCAGG - Intergenic
904005883 1:27363007-27363029 TTCCCTAGGAGGAACAGGCCTGG - Exonic
914746726 1:150506724-150506746 CTCCTCAGGATGAGCAGGACTGG + Intronic
915100170 1:153493462-153493484 CTCCTGGGGAGGAACATGCCTGG - Intergenic
917844177 1:179006586-179006608 CTCAGAAGCAGGACCAGGCCGGG + Intergenic
918285911 1:183054859-183054881 CTACTGAAGAGGAGCAGGCCAGG + Intronic
919803891 1:201369435-201369457 CTCCTAAGGAGGGCCCAGCATGG + Intronic
921312457 1:213857783-213857805 TTCCTGAGAAGAACCAGGCCAGG - Intergenic
922616550 1:226964450-226964472 CTCTTAGGGACGGCCAGGCCTGG + Intronic
922757942 1:228106871-228106893 CTCCTGAGGAGCGCCGGGCCAGG - Exonic
1064366009 10:14708369-14708391 CTCCTAAGGTGGGCCAGGTGCGG - Intronic
1065070149 10:22015019-22015041 CTCCTAAGGAAGACCAGTGCAGG - Intergenic
1065240029 10:23695389-23695411 CCCCCCAGGAGGGCCAGGCCGGG + Intronic
1066537334 10:36406199-36406221 TTCCTAAAGAGGACCTTGCCAGG + Intergenic
1066644456 10:37591670-37591692 TTCCTAAAGAGGACCTTGCCAGG + Intergenic
1066746580 10:38607668-38607690 CTCCAAAGGAGGGGAAGGCCTGG + Intergenic
1070962923 10:80511545-80511567 CTGCTAAGGAGGGCCAGGGCTGG + Intronic
1074771521 10:116737946-116737968 CTCCTGGGGATGCCCAGGCCTGG + Intronic
1076411687 10:130255946-130255968 GTGCTAAGGAGAACCAGGACTGG - Intergenic
1076751777 10:132546921-132546943 CTGCTAACCAGGGCCAGGCCTGG - Intronic
1078638751 11:13076443-13076465 TACCTAAGGCAGACCAGGCCAGG + Intergenic
1081847823 11:46253357-46253379 TCCCAAAGGAGGAACAGGCCTGG - Intergenic
1082778197 11:57264028-57264050 GTTCTAAGCAGGATCAGGCCTGG + Intergenic
1083033678 11:59616378-59616400 GACCTAATGAGGAGCAGGCCGGG + Intergenic
1083980906 11:66168195-66168217 TTTATAAGGAGGAGCAGGCCAGG - Intronic
1084503236 11:69547693-69547715 CTGCTAAAAAGGATCAGGCCAGG + Intergenic
1085122433 11:73975672-73975694 CTGCCAAGGAGGAGCAGGCAAGG + Intronic
1086368428 11:86132157-86132179 TTCTTAAGAATGACCAGGCCCGG - Intergenic
1088720227 11:112585647-112585669 CTCTTTAGGAGGACAAGGCTGGG + Intergenic
1092060842 12:5549035-5549057 GTCCTAAGGAGCACCAGGGAAGG + Intronic
1092290615 12:7157754-7157776 CTCCTGAGGAGGGGCAGGCCTGG + Intronic
1092984535 12:13833307-13833329 CTCCTCGTGAGGACCAGGCCTGG - Intronic
1093669308 12:21853802-21853824 CTCCTTAGAAGGACCAGGGATGG + Intronic
1095972764 12:47914763-47914785 CTACTAAGGAGAGCCAGGCGCGG + Intronic
1096127409 12:49130178-49130200 CTCCTTTGGAGGACCAAGACAGG + Intronic
1096429917 12:51534467-51534489 CTCCTAAGGATGGACAGCCCCGG - Intergenic
1096692231 12:53328298-53328320 CACCCATGGAGAACCAGGCCCGG - Exonic
1104407849 12:128533319-128533341 CTCCTCCTGAGGGCCAGGCCAGG + Intronic
1104589579 12:130073649-130073671 CTACTCAGGAGGCCCAGGCAGGG + Intergenic
1107954900 13:45502225-45502247 CTCCTAATGAAGGCCAGGACGGG - Intronic
1109949725 13:69484494-69484516 CTTCTAAGCAGGGTCAGGCCTGG + Intergenic
1111743870 13:92240792-92240814 CTCCAAAGGATGGCCAGGCATGG - Intronic
1112000786 13:95207923-95207945 CTCCTAAGGGGAACCAGACACGG + Exonic
1113018622 13:105856866-105856888 CTCCCCAGGAGTTCCAGGCCGGG - Intergenic
1114894379 14:26968721-26968743 CTACTAGGGAGGCCGAGGCCAGG - Intergenic
1117275188 14:54186950-54186972 CTCATAAGGAAGTACAGGCCAGG - Intergenic
1117400120 14:55351466-55351488 CTCCTAAGGAGGACCAGGCCTGG + Exonic
1122138853 14:99650268-99650290 CTCACAGGGAGGACCAGGCTGGG - Intronic
1122413143 14:101536098-101536120 TTCCTAAGGAGGCCCAGGGCAGG - Intergenic
1123726702 15:23110237-23110259 CTCAGAAGGAGGAGCAGGGCAGG + Intergenic
1124120444 15:26883866-26883888 CATCTAAGGAGGACCGGGCGTGG + Intronic
1124884670 15:33674040-33674062 CTCCTAATGAAGACCAGAACTGG + Intronic
1130963953 15:88683602-88683624 ATCCTCAGGAGTCCCAGGCCAGG + Intergenic
1132169247 15:99630848-99630870 CTGCCAAGGAGGAGCAGCCCTGG - Intronic
1133317816 16:4895018-4895040 CTCCTCAGAAGTCCCAGGCCAGG - Intronic
1133656559 16:7870666-7870688 CTACTAGGGAGGACGAGGCAGGG - Intergenic
1135421578 16:22308819-22308841 CTCCTAACCAGGACCCTGCCCGG - Intronic
1136736483 16:32471967-32471989 CTCCAAAGGAGGGGCAGGCCTGG - Intergenic
1137671920 16:50284134-50284156 CTCCTAGGGAGGAGCTGGCCTGG + Intronic
1139278206 16:65747771-65747793 GTCCTAAGCAGGTCCAGGCATGG + Intergenic
1139526402 16:67519390-67519412 CTCCTAAGGAGGAACTGGCCAGG + Intronic
1140940881 16:79720863-79720885 CTCCTAGGGAACACCAGGACAGG - Intergenic
1142266045 16:89064351-89064373 CTCCTAACCAGGACCTGGGCAGG + Intergenic
1203016587 16_KI270728v1_random:357611-357633 CTCCAAAGGAGGGGCAGGCCTGG + Intergenic
1203034922 16_KI270728v1_random:630769-630791 CTCCAAAGGAGGGGCAGGCCTGG + Intergenic
1143055102 17:4156585-4156607 CTCCTAAGAAGGGGCAGGGCAGG + Intronic
1144288853 17:13806283-13806305 CTGCTATGGTGGAACAGGCCTGG + Intergenic
1146909810 17:36641481-36641503 CGCCTAAGGCGCCCCAGGCCCGG - Intergenic
1147165927 17:38593297-38593319 CTCCTCAGGAGGAACAGGGTTGG + Intronic
1147582019 17:41632290-41632312 CTCGTAGGCAGCACCAGGCCTGG + Intergenic
1149993505 17:61395665-61395687 CTGCTAAGGGGCACCTGGCCTGG - Intergenic
1150300960 17:64046613-64046635 CTCCTAGGGAGGACGCTGCCTGG - Intronic
1151688209 17:75662306-75662328 CTGGTAAGGAGGACAATGCCAGG + Intronic
1151829872 17:76543186-76543208 CTCCTGAGCAGGACCTGGCTGGG + Exonic
1152254237 17:79228098-79228120 CTTAGAAGGAGGAGCAGGCCAGG - Intronic
1152637986 17:81437973-81437995 GGCCAAAGGAGAACCAGGCCCGG - Intronic
1156587770 18:38450965-38450987 ATGATAAGGAGGAACAGGCCGGG - Intergenic
1157739656 18:50081151-50081173 CTCCTAAGGTTGACAAAGCCTGG + Intronic
1161518769 19:4711932-4711954 CTCCAGAGGAGAACCAGTCCTGG - Intronic
1162881139 19:13660476-13660498 CTACTCAGGAGGATGAGGCCAGG + Intergenic
1165152755 19:33770626-33770648 CTACCAAGGAGGCCCATGCCTGG - Intronic
1167204411 19:48090842-48090864 CTTCTCAGAAGGAGCAGGCCAGG + Intronic
1167411882 19:49349103-49349125 CTCCCAAGCAGGACTTGGCCAGG - Intronic
925100024 2:1236376-1236398 CTCCCCAGGAGGACCAGGAAAGG + Intronic
926036987 2:9643627-9643649 CTGCTAAGGAAGACTAGGCAGGG - Intergenic
926288986 2:11513760-11513782 GTACCAAGAAGGACCAGGCCTGG - Intergenic
928163415 2:28950735-28950757 CTCCTGCCCAGGACCAGGCCTGG - Intergenic
928444975 2:31325820-31325842 CACCTTAGGAGGCCAAGGCCAGG + Intergenic
929872433 2:45770544-45770566 CTTCACAGGAGGACCAGGCAGGG + Intronic
929963024 2:46510858-46510880 GTCCAAGGGAGGACCCGGCCAGG + Intronic
932344929 2:70989123-70989145 CTCCAAAGGGGGCCCAGGCCTGG + Intronic
934187644 2:89761088-89761110 CTCCAAAGGAGGGGAAGGCCTGG - Intergenic
934308983 2:91846858-91846880 CTCCAAAGGAGGGGAAGGCCTGG + Intergenic
937005714 2:118511061-118511083 CTCCTAATGGTGCCCAGGCCAGG + Intergenic
937314325 2:120921418-120921440 CTCCTGAGCAGGCCCAGACCAGG - Intronic
937986136 2:127638936-127638958 CGCCTGGGGAGGGCCAGGCCAGG + Exonic
939872750 2:147543132-147543154 CTCCTGGTGAGGACTAGGCCTGG + Intergenic
944849752 2:203706294-203706316 TTCTTAAGAAGGAACAGGCCGGG - Intergenic
946398027 2:219453111-219453133 CCCCTGAGGGGGCCCAGGCCTGG + Intronic
948675444 2:239594071-239594093 GGCCTCAGGAGGACCGGGCCTGG + Intergenic
1170598028 20:17820144-17820166 CTCTTCAGGATGACCAGCCCAGG + Intergenic
1170871987 20:20214413-20214435 CTCCTCAGTCTGACCAGGCCAGG + Intronic
1171392204 20:24808933-24808955 CTCCTCAGGAGGCCCAGGGCAGG + Intergenic
1172133669 20:32673175-32673197 CTCCTGAGGAGCCCCAGGGCTGG + Intergenic
1172772544 20:37389897-37389919 CACCTGATGAGGACCAGGCCCGG + Intronic
1173331658 20:42080487-42080509 CTCCTAAGGAGAAGGAGGGCAGG + Exonic
1174393331 20:50231562-50231584 CCCCCAGGGAGGACCTGGCCTGG + Intergenic
1175301133 20:57943478-57943500 CTCCTGAGGGAGGCCAGGCCTGG + Intergenic
1175981797 20:62742450-62742472 CATCTAAGCAGTACCAGGCCCGG - Intronic
1179881569 21:44295272-44295294 CTCCTGGGGAGTACCACGCCGGG - Intronic
1180730691 22:17979937-17979959 CTCCTCAGGAGGCTGAGGCCAGG - Intronic
1180968012 22:19800608-19800630 CTCCTAAGGCTTAGCAGGCCTGG - Intronic
1181026623 22:20131152-20131174 CGCTTAAGGTGGACCGGGCCGGG - Intronic
1182287899 22:29258957-29258979 CCCCTGAGGCAGACCAGGCCAGG + Exonic
1182743618 22:32587618-32587640 CTCCAAAGGCCGACCAGGCCCGG + Intronic
1183730279 22:39614655-39614677 ATCCTCTGGTGGACCAGGCCTGG + Intronic
1184324939 22:43775742-43775764 CATCTAAAGAGGACCAGGCATGG - Intronic
953299103 3:41753622-41753644 CTCAGAAGGAGGAGCAGGGCAGG - Intronic
953742000 3:45546106-45546128 CTCCTATGGAAGAGCAGCCCAGG - Intronic
954138692 3:48594216-48594238 CTCCAAAGGAGGTCCTGGCTAGG + Intronic
954881065 3:53836317-53836339 GTCCTAAGCCCGACCAGGCCAGG + Intronic
954961010 3:54565007-54565029 CTCGTAATGGGGAACAGGCCTGG + Intronic
955319513 3:57964306-57964328 CTCATCAGGAGACCCAGGCCTGG - Intergenic
958449707 3:94258772-94258794 CTCCTAAGGAGGACTAGAGATGG + Intergenic
959294835 3:104522139-104522161 CTACTAGGCAGGCCCAGGCCTGG - Intergenic
962748998 3:138419067-138419089 CTCTGAGGAAGGACCAGGCCTGG + Intergenic
966602243 3:181787306-181787328 CTCCATAAGAGGGCCAGGCCGGG - Intergenic
967593149 3:191301120-191301142 CACCTAAAGAGGAACAGGCTGGG - Intronic
968871205 4:3243482-3243504 CTTCCCAGGAGGCCCAGGCCCGG - Exonic
969207515 4:5657893-5657915 ACCCAAAAGAGGACCAGGCCAGG - Intronic
969514185 4:7637401-7637423 CTCCAAAGCAGGACCAGGGACGG - Intronic
971387202 4:26151782-26151804 CTCCAAAGGAGGCCTTGGCCTGG + Intergenic
974191299 4:58507163-58507185 CTCCCAAGTAGCACCATGCCTGG + Intergenic
985634425 5:1028826-1028848 GTCCTCAGGAGGGCGAGGCCAGG + Intronic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
993007122 5:82440710-82440732 CTCCTGAGGAGGCCGAGGCAAGG + Intergenic
993014429 5:82519646-82519668 GTCCTCAGGAGGACAAGTCCAGG - Intergenic
996646362 5:125823053-125823075 ATCCTATGGAGGATCAGGCCAGG - Intergenic
997030490 5:130121834-130121856 CTGCTAAGGAGGATGAGGCTGGG + Intronic
998599156 5:143567241-143567263 CTTCTAAGAAGGAGTAGGCCTGG - Intergenic
1000120172 5:158189754-158189776 CTGCCAAGAAGGACCAGGCTTGG - Intergenic
1001431770 5:171667778-171667800 ATCCTGAGCCGGACCAGGCCCGG - Intergenic
1001549665 5:172593816-172593838 CTACTCAGGAGGACCAGGGAAGG + Intergenic
1002531442 5:179848670-179848692 CTCCTGAGAAAGACAAGGCCAGG + Intronic
1004923874 6:20401560-20401582 CTCCCACGGAAGACCACGCCTGG - Intergenic
1005687834 6:28272227-28272249 TGCCTAAGGAGCTCCAGGCCCGG + Exonic
1005870339 6:29970748-29970770 AACATAAGGAGGATCAGGCCAGG - Intergenic
1006898233 6:37484208-37484230 CTCCCCTGGGGGACCAGGCCTGG - Intronic
1007251034 6:40495175-40495197 CTGGTGAGGAGGACCAGGCAGGG - Intronic
1013575837 6:111483069-111483091 CTCCTCAGGAGCACCCGGCAAGG + Exonic
1015275239 6:131377328-131377350 CCCCCAGGGAGGTCCAGGCCAGG - Intergenic
1016983361 6:149874233-149874255 CTCCTCAGGAAGAAAAGGCCAGG - Intergenic
1019446951 7:1076317-1076339 CCGCCAAGGAGGAGCAGGCCAGG + Intronic
1019980603 7:4619024-4619046 CTCCTCAGGAGGATGAGGCAGGG + Intergenic
1020277529 7:6633996-6634018 ATCCTCAGGTGGCCCAGGCCTGG + Intergenic
1020755823 7:12201902-12201924 CTCCTGAGTAGTACCATGCCCGG - Intergenic
1022110147 7:27225270-27225292 CTCGAAAGGAATACCAGGCCGGG + Intergenic
1022256835 7:28666714-28666736 CTACTCAGGAGGCCCAGGCAGGG + Intronic
1022279234 7:28889460-28889482 CTACTTAGGAGGCCCAGGCAGGG + Intergenic
1026901083 7:74037889-74037911 CTCCCAAGGATGAGTAGGCCGGG + Intronic
1028223771 7:88226276-88226298 CTCCTAAAGAGAAGCAGTCCTGG + Intronic
1029246344 7:99204731-99204753 CTCCCAAGTAGCACCATGCCTGG - Intronic
1029421961 7:100476527-100476549 CTCCAAAAGAGGAACAAGCCAGG - Intronic
1034144100 7:148853126-148853148 CTCATAAGGATGGCCAGGCATGG + Intronic
1035459886 7:159032123-159032145 CTCCTGAGAAGGACCCAGCCAGG - Intronic
1039953257 8:42188478-42188500 CGCCTAAGGCCGAACAGGCCTGG + Intronic
1040536676 8:48316698-48316720 TAGCTAAGCAGGACCAGGCCTGG + Intergenic
1040599646 8:48870808-48870830 CTCTTAAGCAGGGCCAGGACAGG + Intergenic
1042315225 8:67419144-67419166 CTGCTAAGGAGTACCACACCTGG - Intergenic
1042410023 8:68454391-68454413 CTCCCAACAAGGACAAGGCCAGG - Intronic
1042992982 8:74661494-74661516 ATGTTAAGAAGGACCAGGCCAGG - Intronic
1047477037 8:125242575-125242597 ATGCTAAGGAGGACCCTGCCTGG + Intronic
1049328545 8:142037719-142037741 CTCCTGAGGAGGACAGGCCCAGG + Intergenic
1049772298 8:144389124-144389146 CTCCTAACTGGGGCCAGGCCTGG + Intronic
1051131874 9:13871203-13871225 CTCCCAACGAGGAAAAGGCCAGG - Intergenic
1051911200 9:22154993-22155015 CTGCCCAGGAGGTCCAGGCCTGG - Intergenic
1054881404 9:70148602-70148624 CACCTAGGGAGGGCCAGGCATGG + Intronic
1058878221 9:109262619-109262641 CTCTTAAGAGGGAGCAGGCCTGG - Intronic
1059177587 9:112181306-112181328 GCCCTAAGGAGAAGCAGGCCAGG + Intergenic
1060870535 9:127036278-127036300 CTCCAATGGCTGACCAGGCCTGG - Intronic
1061372148 9:130203483-130203505 CTCCCAAGGAGGGCCAGGGCAGG + Intronic
1061393941 9:130333129-130333151 CACCTACTGTGGACCAGGCCAGG + Intronic
1187590763 X:20714618-20714640 TTCCTAACGAGGACCACCCCAGG + Intergenic
1188614218 X:32137498-32137520 CTGATAAGGAGAACCTGGCCAGG + Intronic
1189679935 X:43505385-43505407 CTCAGAATGAGGAGCAGGCCAGG - Intergenic
1191846414 X:65550833-65550855 CTCCTCAGGAGGACAATGCCGGG + Intergenic
1192050599 X:67720721-67720743 CTCCATAGGATGAGCAGGCCTGG - Intronic
1192489956 X:71567627-71567649 CTCCTAAAGAGGAACACGTCAGG + Exonic
1195322012 X:103728130-103728152 CACCTGAGGAGGACCTGCCCTGG + Exonic
1197043039 X:121963224-121963246 CTTCTAAGGAGGACCAAACAAGG - Intergenic
1198553699 X:137770636-137770658 CTCTTAATGAGGGCCAGGCACGG + Intergenic
1199985465 X:152946968-152946990 GCCCTGTGGAGGACCAGGCCAGG + Intronic
1200112230 X:153746813-153746835 CTCCAAAGGAGGGGCAGGCCTGG + Intergenic
1200834992 Y:7724522-7724544 CCCCTGAGGAGGATCAAGCCAGG - Intergenic
1201963252 Y:19705910-19705932 CTCCTTCTGAGGTCCAGGCCAGG + Exonic