ID: 1117400794

View in Genome Browser
Species Human (GRCh38)
Location 14:55356984-55357006
Sequence CTAGCTTTTTTGAGGAAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117400794_1117400797 5 Left 1117400794 14:55356984-55357006 CCGTTTTTCCTCAAAAAAGCTAG 0: 1
1: 0
2: 0
3: 27
4: 337
Right 1117400797 14:55357012-55357034 CAATCTTTGTGAGTTGGTCAAGG 0: 1
1: 0
2: 0
3: 19
4: 116
1117400794_1117400796 -1 Left 1117400794 14:55356984-55357006 CCGTTTTTCCTCAAAAAAGCTAG 0: 1
1: 0
2: 0
3: 27
4: 337
Right 1117400796 14:55357006-55357028 GTGTTGCAATCTTTGTGAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 133
1117400794_1117400798 16 Left 1117400794 14:55356984-55357006 CCGTTTTTCCTCAAAAAAGCTAG 0: 1
1: 0
2: 0
3: 27
4: 337
Right 1117400798 14:55357023-55357045 AGTTGGTCAAGGTACCTGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 118
1117400794_1117400799 17 Left 1117400794 14:55356984-55357006 CCGTTTTTCCTCAAAAAAGCTAG 0: 1
1: 0
2: 0
3: 27
4: 337
Right 1117400799 14:55357024-55357046 GTTGGTCAAGGTACCTGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117400794 Original CRISPR CTAGCTTTTTTGAGGAAAAA CGG (reversed) Intronic
905458626 1:38106119-38106141 CCAGCTTTTTGAAAGAAAAAAGG - Intergenic
905493614 1:38365073-38365095 CTTGCATTTTGGAGGAAAAGGGG + Intergenic
906560827 1:46755600-46755622 CTAGCTTTATTGGGGACTAAAGG + Intergenic
907864361 1:58385251-58385273 TTAGCTTTGTTGAGGCATAATGG - Intronic
907893233 1:58656551-58656573 CTATCTTTTTTGAGGATGAATGG + Exonic
909659593 1:78067390-78067412 GCATCTTTTTTGAGGAAAACAGG - Intronic
910405821 1:86889251-86889273 AAAACTTTTTTGAAGAAAAAAGG + Intronic
910512189 1:88019735-88019757 ATAGTATTTTTGAGGACAAAAGG + Intergenic
910676870 1:89823317-89823339 TTAGCGATTTTGAGAAAAAAAGG - Intronic
910678566 1:89839982-89840004 ATAGCTTTTCTGAGGACTAATGG - Intronic
917255083 1:173106643-173106665 CTAGATTTTTTAAGTGAAAATGG - Intergenic
918856691 1:189764590-189764612 AAAGCTTTATTGTGGAAAAAGGG + Intergenic
919565201 1:199176266-199176288 CTAGCATTTTTCAAGTAAAATGG + Intergenic
919641992 1:200054595-200054617 CTAGCATTTCTGTGGAAAATAGG + Intronic
919861882 1:201744741-201744763 AGAGCTTATTTGAGGAAAGAGGG + Intronic
920659637 1:207904563-207904585 TTAGCTGTTTTGAGGAACAAAGG + Intronic
920877462 1:209849864-209849886 GTAGCCCTTCTGAGGAAAAACGG - Intronic
921380564 1:214520211-214520233 CAGGCTTTCTTGAGGAGAAAAGG + Intronic
922793352 1:228323081-228323103 CAAGCTACTTTGAGGCAAAAGGG - Intronic
923563217 1:235057451-235057473 CTTGCTTTTCTGTGTAAAAATGG + Intergenic
924150603 1:241125380-241125402 CTAGATGATTGGAGGAAAAAGGG - Intronic
924793466 1:247274438-247274460 ATTGGTTTTTTGAGAAAAAAAGG - Intergenic
1063501893 10:6562987-6563009 TTAGTTTTTTTGTTGAAAAAAGG + Intronic
1063960267 10:11300752-11300774 CAAGCTCGTTTGAGGCAAAACGG + Intronic
1064383573 10:14869172-14869194 CTAGCTTTTTTGAGAAGACAGGG + Intronic
1064558960 10:16576928-16576950 CTTGCTCTTTTTAAGAAAAAGGG + Intergenic
1065056159 10:21844704-21844726 CTATCATTTAAGAGGAAAAATGG + Intronic
1065481471 10:26198405-26198427 CTCGTTTTTTTGAGGAAACTTGG - Intronic
1066275782 10:33866988-33867010 CTAGCATTTTTGAGAAAACCAGG + Intergenic
1066669833 10:37825127-37825149 TTACCTTTTTAGAGGAACAATGG - Intronic
1066797539 10:39139478-39139500 CTAGTTTTTATGAGGAAACTCGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068572814 10:58649693-58649715 TTAGCTATTCAGAGGAAAAAGGG - Intronic
1068579920 10:58727967-58727989 CTAGCATTTTTTAGCAAAAAAGG - Intronic
1068736451 10:60418476-60418498 CTATATTTCTTGAGGAAAAGTGG + Intronic
1073676047 10:105648182-105648204 CTGCATTTTTTGAGGAAGAAAGG - Intergenic
1073695435 10:105861138-105861160 CTAACTTTTGTGAGGCAAGAAGG + Intergenic
1075939297 10:126375370-126375392 CTATCTTTTTTGATGAGAGATGG + Intronic
1076282921 10:129265031-129265053 CTAGCTACTTTGAGGATGAATGG - Intergenic
1078801645 11:14650763-14650785 CTAGCTTTGGTGATGAAAGAAGG + Intronic
1079361288 11:19772580-19772602 CCAGCTATTTGGAGGCAAAATGG + Intronic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1080290773 11:30668814-30668836 ATAGCTTTTTAGAGGAGTAAAGG + Intergenic
1080441166 11:32295976-32295998 CTAGCTTATTAGAGGATAAGCGG - Intergenic
1080941745 11:36926398-36926420 CTAGCTTTTTGCAAGAGAAAGGG - Intergenic
1081253482 11:40863938-40863960 TAAGATTTTTTGATGAAAAAAGG - Intronic
1084614303 11:70225707-70225729 CCAGCTTCTCTGAGGAAAGATGG + Intergenic
1086208474 11:84289314-84289336 CAAGCTTTTATGAGGAAATTAGG + Intronic
1086669469 11:89529303-89529325 CTAGCTTTAAGGAAGAAAAAAGG + Intergenic
1086758509 11:90596109-90596131 CTAGCTTTTTTGAGTTGAAAGGG + Intergenic
1086875597 11:92091889-92091911 CTAGCTTTATTAAGGTATAATGG - Intergenic
1087121340 11:94577462-94577484 CTAGCTTTTGTGACAGAAAAAGG - Exonic
1088354837 11:108932056-108932078 CTAGCCCTTTAGAGGAAAAAGGG - Intronic
1089911105 11:122101519-122101541 CTAGCTTTTCTGAGAGGAAAAGG - Intergenic
1090266045 11:125353539-125353561 CTAGCCTTTGTGAGGAAGAAGGG + Intronic
1091030058 11:132178302-132178324 GTAGCTTTTCTGAATAAAAATGG - Intronic
1091193377 11:133712656-133712678 CTAGCTGTGCTGAGAAAAAATGG + Intergenic
1092099080 12:5868626-5868648 CCAGCTTTTTCTAGGAAAAAAGG - Intronic
1092502347 12:9061010-9061032 CTAGCTTCTCGGATGAAAAAAGG - Intergenic
1092901371 12:13062596-13062618 CTAGATTTTTTTAGATAAAATGG - Intronic
1095456344 12:42389620-42389642 CGAGTTTCTATGAGGAAAAATGG + Intronic
1095816992 12:46434230-46434252 CTAGCCATTTTGGGGGAAAAAGG + Intergenic
1097573856 12:61366313-61366335 CCAGCATTTTAAAGGAAAAAAGG - Intergenic
1097965282 12:65572717-65572739 CTAGCTTTAGTAGGGAAAAATGG - Intergenic
1098650120 12:72954317-72954339 CCTGCTTTTTTGAAGGAAAATGG - Intergenic
1100690478 12:97033985-97034007 CTAGCTTTATTAGGGACAAAAGG + Intergenic
1101268325 12:103115728-103115750 CTTGCTTTTGTGAACAAAAAGGG + Intergenic
1106290257 13:28354659-28354681 CTACTTTTTTTAAGCAAAAAAGG + Intronic
1109398725 13:61796041-61796063 CTACTTATTTTGTGGAAAAAAGG - Intergenic
1109585421 13:64395881-64395903 ATAGATTCCTTGAGGAAAAAAGG - Intergenic
1110707865 13:78615495-78615517 AGAACTTTTATGAGGAAAAAAGG + Exonic
1112001652 13:95215451-95215473 CTAGCTGCTTAGAGCAAAAATGG + Intronic
1113122416 13:106938038-106938060 CTGCCTTTTTTGAGGAACATTGG + Intergenic
1113298636 13:108990816-108990838 CTACATTTTTAGAGAAAAAATGG + Intronic
1115210024 14:30957664-30957686 ATTGCTTTTTTCAGGAAATAAGG - Intronic
1115863243 14:37712862-37712884 TTAGCTATTTTAAGCAAAAAGGG + Intronic
1116554886 14:46290532-46290554 ATAGGTTTTTTAAGCAAAAATGG - Intergenic
1116654221 14:47631017-47631039 CTATCTTTTCAGAGGAAAAAAGG - Intronic
1116766114 14:49071747-49071769 ATAGCTGTTTTGAGGAAACAAGG + Intergenic
1116778469 14:49209214-49209236 CCAGCTTTATTGAGGTATAACGG + Intergenic
1117400794 14:55356984-55357006 CTAGCTTTTTTGAGGAAAAACGG - Intronic
1117637714 14:57763292-57763314 CTAGCTTATTTGTTGACAAAAGG + Intronic
1117645792 14:57850985-57851007 CTAGCTTTTTTGCAGGAAGAGGG - Intronic
1119925238 14:78487433-78487455 AAATCTTTTTTGAGGCAAAATGG - Intronic
1120076288 14:80162557-80162579 CTACCTTTTTTGAGGGGAAAAGG - Intergenic
1120430293 14:84404514-84404536 CCAGATTTTTCCAGGAAAAAAGG - Intergenic
1202872364 14_GL000225v1_random:176904-176926 CTGGCATTTTAGAAGAAAAATGG + Intergenic
1123685449 15:22793851-22793873 CTGGCTTTGTTGAGGATCAATGG + Intronic
1126839574 15:52704013-52704035 CTACCTTTTTATAGGAAATAAGG + Intronic
1127298245 15:57628779-57628801 ATAGCTCTTTTAAGAAAAAAGGG + Intronic
1127522099 15:59753371-59753393 CTAACTTTATTGTGGAAAATGGG - Intergenic
1127805032 15:62511412-62511434 CAAGTATTTTTGAGAAAAAAAGG - Intronic
1127984494 15:64059222-64059244 CATGCATATTTGAGGAAAAATGG + Intronic
1128326732 15:66728883-66728905 CCAGCCTTTTTGAGGACACAAGG + Intronic
1129244522 15:74271419-74271441 CTAGTTTCTTTGGGGAGAAAGGG - Intronic
1131665973 15:94571461-94571483 CAAGCTGGTTTGAGGCAAAATGG + Intergenic
1133365473 16:5205700-5205722 CTTGCATATTTGAAGAAAAAGGG + Intergenic
1134406860 16:13968685-13968707 ATAGCTATTTTGAGGAAACTCGG - Intergenic
1134757857 16:16684691-16684713 CTAGATTTAATGAGGATAAATGG - Intergenic
1134988213 16:18674489-18674511 CTAGATTTAATGAGGATAAATGG + Intergenic
1135004527 16:18807415-18807437 CTAGGTTTTTTGCGAAAATAAGG + Exonic
1135168997 16:20166397-20166419 CTAGCTGTTGTGGGGAATAAAGG - Intergenic
1135242094 16:20816648-20816670 ACAGTTTTTTTAAGGAAAAATGG + Intronic
1136638040 16:31538010-31538032 GCAGCTTTATTGAGGTAAAATGG - Intergenic
1136666687 16:31819162-31819184 GCAGCTTTATTGAGGTAAAATGG + Intergenic
1137583441 16:49649148-49649170 CTACCTTTCATGGGGAAAAAAGG + Intronic
1138902099 16:61285333-61285355 CTAGCTTTCTTGAGTCAGAATGG + Intergenic
1139837726 16:69853190-69853212 CTAGGTATTTTGAGCAGAAAAGG + Intronic
1140780112 16:78288148-78288170 CTAGGTTTTTAAATGAAAAACGG + Intronic
1141373865 16:83512013-83512035 CTAGCTTTTTTAAAAAATAAAGG + Intronic
1141486337 16:84342750-84342772 GTAGGTTTTTAAAGGAAAAAAGG + Intergenic
1141588098 16:85048529-85048551 CTTTGTTTTTTGAGAAAAAAAGG - Intronic
1143906028 17:10209832-10209854 TTGGCTTTTTTGTGGACAAAGGG + Intergenic
1144065023 17:11617259-11617281 CTAGCTCTTATGAGGAAATATGG - Intronic
1144186575 17:12802263-12802285 CTAGCTAATTTTAGCAAAAAAGG + Intronic
1144204714 17:12971916-12971938 TTAGCTGTTTTAAGGAAATATGG - Intronic
1144567283 17:16370123-16370145 CTAGCTTTATTGGGGATAACTGG + Intergenic
1145861028 17:28210356-28210378 CCAGCTTTATTCAGGAATAATGG - Intergenic
1146861781 17:36308424-36308446 ATAGATTTGTTGATGAAAAAAGG + Intronic
1147092109 17:38112528-38112550 ATAGATTTGTTGATGAAAAAAGG + Intergenic
1147105100 17:38207971-38207993 ATAGATTTGTTGATGAAAAAAGG - Intergenic
1148424398 17:47580507-47580529 ATAGATTTGTTGATGAAAAAAGG + Intronic
1149966138 17:61166098-61166120 CTAGCAATTATGGGGAAAAAGGG - Intronic
1153771704 18:8422036-8422058 TTAGCGTTTCTGAGGAAACACGG - Intergenic
1153865459 18:9264211-9264233 CCAGCTGTTTTAAGGCAAAAGGG + Intronic
1153957639 18:10111806-10111828 CCAGATTTTTAGAGCAAAAAAGG - Intergenic
1153987495 18:10366564-10366586 CAAGATTTTTTGAAGAAACACGG - Intergenic
1154989932 18:21591079-21591101 GTATCTTATTTGGGGAAAAAAGG + Intronic
1155110732 18:22711836-22711858 GTAGCTTTTAAGAAGAAAAATGG - Intergenic
1156873123 18:41971424-41971446 ATTGCTCTTTTAAGGAAAAATGG + Intronic
1156883242 18:42105455-42105477 CTAGTGTTTTTGCAGAAAAATGG + Intergenic
1157948668 18:52009889-52009911 CTGGTTTATTTGAGGCAAAATGG - Intergenic
1158183181 18:54741356-54741378 CTAACTTTTTTGTGACAAAAGGG - Intronic
1158524869 18:58204020-58204042 CTAGGTTTTTGGAGTCAAAATGG - Intronic
1158726545 18:59978399-59978421 ATAGCTTTATAGTGGAAAAACGG - Intergenic
1158789345 18:60757835-60757857 CTAGTTGTCATGAGGAAAAAGGG + Intergenic
1159313076 18:66735670-66735692 CTAACCTTTTTGAGGCTAAAAGG + Intergenic
1160003821 18:75053362-75053384 CTAGCTTTTCTGAGAAGCAAGGG - Intronic
1161746807 19:6065344-6065366 CTTGCCTTTTTAAGAAAAAAAGG + Intronic
1163723256 19:18908255-18908277 CTTACTTTTTTGTAGAAAAAGGG - Intronic
1165185746 19:34019485-34019507 CTCGCTTTTTTGAGGGAGAAGGG + Intergenic
1165619353 19:37232055-37232077 AAAACCTTTTTGAGGAAAAAAGG - Intronic
1167014395 19:46830974-46830996 GTATCTTTTTTCAGGAAGAAGGG - Intergenic
1168106781 19:54170371-54170393 CTTGTATTTGTGAGGAAAAAGGG + Intronic
1168355530 19:55697434-55697456 TCAGCTTTTTTGAAGAGAAAGGG - Intronic
926776062 2:16424336-16424358 CTGCCTCTTTTGAGGAGAAATGG + Intergenic
927621370 2:24663504-24663526 CTAGTTTGTTGAAGGAAAAAAGG + Intronic
930223640 2:48770065-48770087 GTATGTTTTTTGAGAAAAAAAGG + Intronic
930429717 2:51258954-51258976 GGAGCTATTTTAAGGAAAAAGGG + Intergenic
931093315 2:58910960-58910982 ATAGCTTCTTGGAGGAAGAAGGG + Intergenic
931162466 2:59707735-59707757 AGAGAATTTTTGAGGAAAAAGGG + Intergenic
931276775 2:60750868-60750890 CTAGCCTTTTTCAGGAAAGAAGG - Intergenic
931641480 2:64384252-64384274 AGAACTTTTTTGAGAAAAAAAGG + Intergenic
931686530 2:64798809-64798831 GTACTTTTTTTGGGGAAAAAAGG + Intergenic
932256138 2:70288767-70288789 GTAGCTTGTTTAAAGAAAAAAGG + Intronic
932906145 2:75754442-75754464 CTAGCATATTGGAGGAAAATAGG - Intergenic
933522728 2:83393151-83393173 CTATCTCTTTGCAGGAAAAAAGG - Intergenic
935192952 2:100793157-100793179 CTAGCTTATTTGGGAAAAAAGGG - Intergenic
937797022 2:126035906-126035928 CTAACTTACCTGAGGAAAAAAGG - Intergenic
938851223 2:135262472-135262494 CTAGTCTTTTTGAGGTAATATGG - Intronic
939556358 2:143678494-143678516 CTCGCTGTTGTGAGGAAGAAAGG - Intronic
939839918 2:147174342-147174364 TTGGCTTTTTTGAGGGAAAGTGG - Intergenic
939954634 2:148517361-148517383 CTAGCTTTTGTGAGCAAAGGTGG + Intronic
941277798 2:163512873-163512895 GTAACTTTTTTGAGGCAGAAAGG - Intergenic
941369458 2:164646237-164646259 GTAACTTTCTTGAGGAAAAAGGG + Intergenic
941379210 2:164771081-164771103 CTAGCTTTTTATAAGAAAAGTGG - Intronic
943272066 2:185818402-185818424 ATAGATTATTTGAGGAAACAAGG + Intronic
943468183 2:188256895-188256917 CTGTCTTTTTTGAGGACAACAGG + Intergenic
943599785 2:189901707-189901729 CTAACATTTTTGGGGAAAAAAGG - Intronic
944118548 2:196215047-196215069 GTAGCATTTTTGAGGTAAAAAGG - Intronic
945512755 2:210723071-210723093 CTAGCTTTTTTGGGGGGCAAGGG + Intergenic
946269004 2:218573813-218573835 TAAGCTTTCTTGGGGAAAAAAGG + Intronic
946661524 2:222005860-222005882 TTTGCCTTTTTGAGGAAGAAGGG + Intergenic
946960798 2:224983904-224983926 CTAGTTGTTTAGAGTAAAAATGG - Intronic
947511525 2:230758886-230758908 CTAGTTTTTTTACTGAAAAATGG + Intronic
948019554 2:234719399-234719421 CTGGCTTTTTGCAGGAAAACGGG - Intergenic
948500661 2:238390959-238390981 TTTTCTTTTTTGAGAAAAAAGGG + Intronic
948658241 2:239490187-239490209 CTAGACTTTTTGAGGACAGATGG - Intergenic
1168995231 20:2128287-2128309 CAAGCTTTTTGAAGGTAAAAGGG - Intronic
1174983728 20:55425603-55425625 CTATCTTTTTGGAGGGTAAATGG - Intergenic
1175840868 20:62026470-62026492 CTAGCTCCTTTGATGGAAAAGGG + Intronic
1177029434 21:15964136-15964158 CCAGCTTTTTATAGGAAAATTGG + Intergenic
1178155864 21:29853585-29853607 CTAGCTTTTTGGAGAAAAATAGG + Intronic
1181918893 22:26303894-26303916 CTATCTTTTATGAGGATCAAAGG - Intronic
949641906 3:6045783-6045805 AGAGCTTTTTGGAGGAAAAAAGG - Intergenic
949804826 3:7943297-7943319 ATAGCTACTTTGGGGAAAAAGGG - Intergenic
950632033 3:14288442-14288464 ATAGACTGTTTGAGGAAAAAGGG - Intergenic
951595374 3:24312855-24312877 CTGGCTTCTTTGTGGAAAATGGG + Intronic
951876947 3:27437854-27437876 GTAGTTTTGGTGAGGAAAAAGGG - Intronic
953477304 3:43216367-43216389 CCAGCTGTTGTGAGGCAAAAGGG - Intergenic
955131163 3:56170511-56170533 CTTGCTTTTTAGAGGAACTAAGG - Intronic
956703429 3:71979156-71979178 CTAGTGTTTTTAAAGAAAAAAGG + Intergenic
957117757 3:76048684-76048706 CTAGCTTTTTAGGGGTCAAATGG - Intronic
957602996 3:82362224-82362246 GTAGCTTTGAGGAGGAAAAAGGG + Intergenic
958261621 3:91387853-91387875 CTAGCTATTTTCAGCAGAAAAGG - Intergenic
958564654 3:95794260-95794282 TTAGCATGTTTGAGGAAAAGGGG - Intergenic
958574765 3:95934770-95934792 CTAGATCATTTGAGGATAAAAGG - Intergenic
958898466 3:99857379-99857401 CTTGCTTGTTTGAGGAGAACAGG + Intronic
959466030 3:106688770-106688792 CTAGCCTTTAAAAGGAAAAAAGG + Intergenic
959513357 3:107239166-107239188 CTAGCTGTTATAAGGAAAAGTGG + Intergenic
959930199 3:111972420-111972442 CTAGCTTTTTGTAGTTAAAAAGG + Intronic
960053100 3:113256043-113256065 ATGGGTTTTTTGAGGATAAATGG + Intronic
960268613 3:115649911-115649933 CTGGCTGTTCAGAGGAAAAATGG + Intronic
960389628 3:117061227-117061249 ATATCTTTTTTTAAGAAAAAAGG + Intronic
960391690 3:117084651-117084673 CTGGCATGTTTGAGGAAAATAGG - Intronic
960394434 3:117118958-117118980 CTCTGATTTTTGAGGAAAAAGGG + Intronic
961090740 3:124109605-124109627 CTGGCTTTATTGAGATAAAATGG + Intronic
961846937 3:129773278-129773300 CAAGAATTTTTGAAGAAAAATGG - Intronic
964396394 3:156250363-156250385 CCAGCTGTGTTCAGGAAAAAGGG + Intronic
964620870 3:158718920-158718942 CTAGCTTTCCTGAGGAAAGAAGG + Intronic
964714891 3:159711727-159711749 CTAGCTATTTTAAGCATAAAGGG + Intronic
965301153 3:167006598-167006620 CTAGCTGCTCTGTGGAAAAATGG + Intergenic
966264494 3:178022653-178022675 CTACCTTCTTTCAGGAATAAGGG + Intergenic
967136699 3:186518530-186518552 GTAGCTTTTTGTAAGAAAAATGG - Intergenic
968767546 4:2481336-2481358 CCACCATTTGTGAGGAAAAATGG - Intronic
969887144 4:10225143-10225165 CTGCCTTATTTGAGGAAGAAGGG - Intergenic
971298235 4:25419809-25419831 TTAGCTTTTGTGAGCAAGAAAGG + Intergenic
971769612 4:30879272-30879294 CTTGTTTATTGGAGGAAAAAAGG - Intronic
973186132 4:47331204-47331226 GTAGCTTTTTTGATGAGAAGAGG + Intronic
974444438 4:61961215-61961237 CTATCTTTTTTTAAGCAAAAGGG - Intronic
974611949 4:64229091-64229113 CTAGCTTTTTTGGGGGAGGAAGG + Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
975940794 4:79643291-79643313 CTAGATTATTGGAGTAAAAATGG + Intergenic
977606715 4:98992368-98992390 TTAGCTTTTTTGTGGAGACAGGG - Intergenic
980477831 4:133342280-133342302 CTAGATTATCTAAGGAAAAAAGG - Intergenic
980822094 4:138030850-138030872 CTAGCTTTCTTGAAAAAAAGGGG - Intergenic
981484432 4:145270419-145270441 CAAGTTTTTTTGGGGGAAAATGG - Intergenic
981533784 4:145778441-145778463 CTAACTTTTTTAAAAAAAAAAGG - Intronic
981586408 4:146308059-146308081 ATAGCATTTTAGAGGAAAAAGGG - Intronic
982048082 4:151469095-151469117 TCAGCTTTTTTGAGGGAAGAGGG - Intronic
982057355 4:151565486-151565508 CTAGCTTTTCTGAAAAATAATGG - Intronic
982265073 4:153530967-153530989 CTAGCTATTTTAAGCAGAAAGGG - Intronic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983749778 4:171252636-171252658 CTAGGTGTTTTGGGGAGAAAGGG - Intergenic
983870577 4:172820776-172820798 TTTGATTTTTTGAGGAGAAAAGG - Intronic
984280590 4:177665885-177665907 TTTGGATTTTTGAGGAAAAAGGG + Intergenic
984956917 4:185053956-185053978 CTGGCTTTTGTGCGGAGAAACGG + Intergenic
985319150 4:188689452-188689474 CTTTCTTTTTTGAGAATAAATGG + Intergenic
985391316 4:189493431-189493453 ATGGCCCTTTTGAGGAAAAATGG + Intergenic
986719689 5:10552205-10552227 CTACCTTTTGGGAGGAAGAAGGG - Intergenic
986993092 5:13576595-13576617 CTGGCTTTGGTGAGGACAAAGGG + Intergenic
988809404 5:34769587-34769609 CTAGACTTTTAGAGGAGAAAAGG + Intronic
988946216 5:36203371-36203393 CTACATTTTTTGAAGCAAAAAGG + Intronic
989155131 5:38337737-38337759 CTAGCTTTATGGAGGGAGAATGG - Intronic
991043453 5:62198297-62198319 CAAGCTTATCTGATGAAAAAAGG + Intergenic
993705954 5:91170852-91170874 CTATCTTTTGCCAGGAAAAAGGG - Intergenic
993798149 5:92296343-92296365 GTAGCATTTTGGAGGAAAGAAGG - Intergenic
994254114 5:97572295-97572317 CTAGCCTTGTTGAAGAAGAAAGG - Intergenic
994930476 5:106176567-106176589 CTGCCTTTTTTGAAAAAAAATGG - Intergenic
995820302 5:116222634-116222656 CTAGCTCTTTTGTGAACAAAAGG - Intronic
995865936 5:116690717-116690739 CTTGTTTTTTTGAGAATAAATGG - Intergenic
996457963 5:123706925-123706947 TTACTTTTTTTGAGAAAAAATGG + Intergenic
996969032 5:129341484-129341506 CAATCTTTGCTGAGGAAAAAAGG + Intergenic
998314363 5:141167884-141167906 CAAGGTTTATTGAGAAAAAAGGG + Intergenic
1000118432 5:158174876-158174898 CTAGCTTTTTCTAGGAACTAAGG + Intergenic
1001620698 5:173082380-173082402 CTAACTTTTTCTAGGAAGAAAGG + Intronic
1001911492 5:175522404-175522426 ATACCTTTTCTGAGGAAACAGGG - Exonic
1003766294 6:9240898-9240920 ATAGTTTTCTTGTGGAAAAATGG - Intergenic
1005143118 6:22656941-22656963 CCAGCCTTGTTGAGGAAAAATGG - Intergenic
1007493737 6:42244539-42244561 CTCCCTTTTGTGAGGAAAGATGG - Intronic
1007973161 6:46073384-46073406 CTAGCTTTTTCCACGAAAATTGG + Intronic
1008477599 6:51949209-51949231 CTAAATTTTTTAAGAAAAAATGG - Intronic
1008692349 6:53993702-53993724 CTATCTTTGTTTAGGAAAGATGG - Intronic
1008993539 6:57632293-57632315 CTAGCTATTTTCAGCAGAAAAGG + Intronic
1009182144 6:60531379-60531401 CTAGCTATTTTCAGCAGAAAAGG + Intergenic
1009847199 6:69149464-69149486 ATAGCTGTTTTGAGGAAACTTGG - Intronic
1010214327 6:73388517-73388539 GTAGCTTTTTTCTTGAAAAAGGG + Intronic
1010327354 6:74580398-74580420 CCAGCTTTATTGAGGTATAATGG - Intergenic
1010462476 6:76129049-76129071 CCAGCTTTATTGAGGTATAATGG + Intergenic
1010793016 6:80086815-80086837 AAAGCTCTTTTGAGGAATAATGG + Intergenic
1011256977 6:85432417-85432439 CTAGTTTTCTGGTGGAAAAAGGG + Intergenic
1011287079 6:85736444-85736466 CAAGCTTTCTTGATGAAACAAGG - Intergenic
1013019366 6:106197351-106197373 CTACCTTTTTTGAAAACAAAAGG - Intronic
1013488018 6:110616887-110616909 ATAGCTTTTTTAATGACAAAGGG + Intronic
1014007754 6:116440768-116440790 ATAGCTTAATTCAGGAAAAAAGG + Exonic
1014112875 6:117639529-117639551 ATTGCTTTTTAGAGTAAAAAGGG - Intergenic
1014175736 6:118328989-118329011 CTAACTATATTAAGGAAAAAGGG + Intergenic
1014332697 6:120089554-120089576 CTAGATCTTTTGAAGAGAAAAGG + Intergenic
1014366737 6:120552710-120552732 CTAGCTAATTTGTGGAAATATGG + Intergenic
1014537808 6:122637272-122637294 CTTGATTTTTTGAGGGGAAATGG + Intronic
1015987386 6:138898079-138898101 CTTGCTTTTTTGGGGGAGAAGGG - Intronic
1017101569 6:150853786-150853808 TTATCTTTTTTAAGGAGAAAGGG - Intergenic
1020566341 7:9800707-9800729 CTAGCTTTCTTGAGGTATGAAGG + Intergenic
1021170955 7:17397475-17397497 ATGGCATTTCTGAGGAAAAAAGG + Intergenic
1022823333 7:33982863-33982885 GTAGCTTTTTGGAAGAAAGAGGG + Intronic
1023438586 7:40163651-40163673 TTAGTTTTTTTGAACAAAAATGG + Intronic
1023545635 7:41315448-41315470 CCAGCTGTTGTGAGGAATAATGG - Intergenic
1024012098 7:45277026-45277048 CCAGCTTTATTGAGGTATAATGG + Intergenic
1024041131 7:45555854-45555876 TTAGCTTTATTGAGGTATAATGG - Intergenic
1028488659 7:91386972-91386994 CTTACATTTTTGAGGAAGAAAGG - Intergenic
1030126854 7:106162275-106162297 ATAGCTATTTTGAGCAGAAAAGG + Intergenic
1031321914 7:120340805-120340827 CTAGCTATTTTGTTGTAAAAGGG + Intronic
1031441897 7:121804760-121804782 CTAGCTTTATTAAGGTATAATGG + Intergenic
1031729850 7:125286296-125286318 TTATCTTTTTTGAGGGAAATAGG + Intergenic
1032175060 7:129616588-129616610 CTAGTTTTTTTTAAGAAACACGG - Intronic
1032584452 7:133133310-133133332 CTAACTTTTTTGAGGATGATGGG + Intergenic
1033728199 7:144144844-144144866 CTAGATCTTATGAGGAAAAGGGG - Intergenic
1033886987 7:145961218-145961240 CTTGCTTTTATAAGGAATAAAGG - Intergenic
1035776620 8:2192294-2192316 GTAACTTGTTTGAGGAAACAGGG - Intergenic
1037487251 8:19359141-19359163 CTAGCTTTCTTGAATAAATACGG + Intronic
1038592573 8:28853523-28853545 CTAACATTTCTTAGGAAAAAAGG + Intronic
1040422568 8:47253766-47253788 CTTGCTTTATTGAGGCAAAGTGG - Intergenic
1040447673 8:47512007-47512029 CGAGCTTTTATGAGGACAGAGGG - Intronic
1040912476 8:52533480-52533502 CTTGGTTTTCTGAGGAACAAAGG + Intergenic
1041266608 8:56071876-56071898 ATAGATTTATTGTGGAAAAATGG - Intronic
1041350178 8:56940446-56940468 CTATCTTATTTAAGAAAAAAAGG - Intergenic
1042583795 8:70312389-70312411 GTATCTTTCTTGGGGAAAAAGGG + Intronic
1043273491 8:78363495-78363517 CCAGCTTCTTTGTGGACAAATGG + Intergenic
1043665541 8:82806933-82806955 TTAGGTTTTGTGAGAAAAAAAGG + Intergenic
1044785469 8:95788250-95788272 GTAGCCTTTTTGAGGATGAAAGG - Intergenic
1045019836 8:98032433-98032455 CTATCTTTTTGAGGGAAAAAAGG - Intronic
1045319530 8:101071437-101071459 GTAGCCTTTTTGAGGATGAATGG - Intergenic
1047024125 8:120808891-120808913 CTAGGTTTTTTTAAAAAAAAGGG + Intronic
1049948065 9:617404-617426 CTAACATTTTTGAGAAAATAAGG - Intronic
1050537084 9:6640104-6640126 AAAGCTTTATTGTGGAAAAAAGG - Intronic
1051016809 9:12487443-12487465 CCAGGTTAATTGAGGAAAAAAGG + Intergenic
1051140635 9:13975502-13975524 CTTACTTCTTTGAGAAAAAAAGG - Intergenic
1051409495 9:16774742-16774764 TTAGTTTTTTTGTAGAAAAATGG - Intronic
1051494872 9:17709201-17709223 CAAGCTTTTTTCAGGCCAAATGG - Intronic
1052778800 9:32759535-32759557 CTAGGTTATTTGAAGAAACATGG + Intergenic
1053089336 9:35259687-35259709 CAAGCTGTTTTGAGGGAAACTGG - Intronic
1053116408 9:35507723-35507745 TTAGCTTTTTTCTGGAAAATCGG - Intronic
1053189760 9:36053573-36053595 ATAGCTTTTTAAAGCAAAAATGG + Intronic
1053510591 9:38684702-38684724 CTACCTTTCATGAGGAAAGAGGG - Intergenic
1055036316 9:71822222-71822244 CAAGTTTTTTTGAGGAGACAGGG + Intergenic
1055322210 9:75093683-75093705 ATAACATTTTTGAGAAAAAAAGG + Intronic
1055371137 9:75600999-75601021 CTAGCTTTTTGGAGTAAAGACGG + Intergenic
1055444872 9:76372539-76372561 ATTGCTTTTTGGAGGAAAAAAGG - Intergenic
1056198892 9:84255624-84255646 TTTGCTTTTTTGAGGTAAGAGGG - Intergenic
1058376352 9:104326694-104326716 CTAGCATTTTTGAGAATGAAAGG - Intergenic
1059291636 9:113230429-113230451 CTTGATTTTTTGAGGAGACAAGG + Intronic
1059741067 9:117150423-117150445 AAATCCTTTTTGAGGAAAAAAGG + Intronic
1059831428 9:118100633-118100655 ATAGCTGTCTTGAGGGAAAACGG + Intergenic
1061468877 9:130806724-130806746 CTAGCTTTTGTGTGTAAGAATGG - Intronic
1061977101 9:134074743-134074765 GTAGCTTTTTTGTTGAAAACTGG - Intergenic
1203732090 Un_GL000216v2:99639-99661 CTGGCATTTTAGAAGAAAAATGG - Intergenic
1185728716 X:2444101-2444123 TTAGATTTTTAGAGGGAAAACGG - Intronic
1186792711 X:13014539-13014561 CTAGATTTTTTTTGGCAAAAAGG + Intergenic
1187489691 X:19739399-19739421 ATTGCTCCTTTGAGGAAAAATGG + Intronic
1187570696 X:20497884-20497906 TTAGCTTTTTTGAGGAACTTTGG + Intergenic
1187642589 X:21311261-21311283 CTGGAATTTTTGTGGAAAAAAGG - Intergenic
1188399074 X:29722171-29722193 TTACCTTTTTTGTGGTAAAAAGG + Intronic
1188430165 X:30097446-30097468 CTGGCTTCTTTCAGGTAAAATGG + Intergenic
1188520955 X:31037164-31037186 TTAGCTTTCTGGAGGATAAAAGG - Intergenic
1188598968 X:31937910-31937932 TTAGCTTTTTTTAGAAAGAATGG + Intronic
1188801785 X:34540968-34540990 ATAACTATTTTAAGGAAAAATGG + Intergenic
1188934046 X:36152124-36152146 TTAGCTTTATTGAGGTAAATTGG + Intergenic
1190472508 X:50797009-50797031 GTTGCTTTCTTGAGGAAAAGAGG + Intronic
1191858631 X:65647934-65647956 CTGGCTTCTTTGTGGACAAATGG + Intronic
1192070643 X:67936838-67936860 CTTGTCTTTTTGATGAAAAAGGG + Intergenic
1192889851 X:75378462-75378484 CTAGCTTTTTTCATGAGAATAGG + Intronic
1193258088 X:79373835-79373857 CTTGCTTTCCTGATGAAAAATGG + Intergenic
1193882511 X:86940889-86940911 CAATGTTTTTTGAGGAAAGATGG + Intergenic
1194984564 X:100476579-100476601 CTAGCTTGTTTGATCAAAAAAGG - Intergenic
1195512180 X:105728877-105728899 CAAGAGTTTTTGAGGAGAAAGGG - Intronic
1195889843 X:109680807-109680829 TTATTTTTTTTGAGGAGAAATGG + Intronic
1197152126 X:123231605-123231627 CTAGCCTTTTTGAGGGAGTAAGG + Intronic
1197249414 X:124199345-124199367 CTAGCTCATATGAGGAAAAATGG - Intronic
1197418389 X:126205362-126205384 CTTGCTGTATAGAGGAAAAAAGG + Intergenic
1198588153 X:138145862-138145884 GAAGCTTTTATAAGGAAAAAGGG + Intergenic
1198629047 X:138615016-138615038 CTAGCTTTTATGGGTGAAAAAGG + Intergenic
1198812319 X:140548047-140548069 CTTGCCTTTTGGAGGCAAAAGGG + Intergenic
1200389424 X:155929273-155929295 GTAGGTTTTTAAAGGAAAAAAGG + Intronic
1201711863 Y:17001108-17001130 CTGTCTTTTCTAAGGAAAAAGGG + Intergenic