ID: 1117400865

View in Genome Browser
Species Human (GRCh38)
Location 14:55357525-55357547
Sequence CTGTTTATTAAGAAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117400864_1117400865 7 Left 1117400864 14:55357495-55357517 CCTTTACATACTGGTACTGAAGT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1117400865 14:55357525-55357547 CTGTTTATTAAGAAGTATGAAGG 0: 1
1: 0
2: 0
3: 22
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117400865 Original CRISPR CTGTTTATTAAGAAGTATGA AGG Intronic
901909953 1:12448620-12448642 TTGATTATAAAGAATTATGAAGG - Intronic
902731397 1:18372173-18372195 TTGTTTATTAAGAACTATGTTGG - Intronic
904629097 1:31828207-31828229 CTGGTCATTAAGAAGCCTGATGG - Intergenic
905081539 1:35326226-35326248 ATCTTTATTTAGAAGTTTGATGG - Intronic
905330507 1:37192190-37192212 CTATTTATTTTGAATTATGATGG + Intergenic
906435915 1:45796522-45796544 CTGTTTCTTAGAAAGTATCATGG - Intronic
906822109 1:48940575-48940597 CTGTTTCTTAAGAAATATGTAGG - Intronic
908779234 1:67673817-67673839 CTGTTTATAAAGAAATTAGAAGG - Intergenic
910393428 1:86767957-86767979 CTGGTTTTGAAGAAGTAGGAAGG - Intergenic
912748292 1:112264373-112264395 ATGTTGATTAAGAAGTATGTTGG - Intergenic
915384554 1:155478215-155478237 CTGTTTATTAAGCTTTTTGAAGG + Exonic
916346710 1:163800317-163800339 CTGCGTATTAAGAGGTATTAAGG - Intergenic
917194906 1:172454820-172454842 CTATACATCAAGAAGTATGATGG - Intronic
917592735 1:176493800-176493822 CTGTTTATTTAGAACTTAGATGG - Intronic
918531495 1:185527245-185527267 CTCTTAATTATGAAGTAAGATGG + Intergenic
919388969 1:196957016-196957038 CTGTTTATCTAGAAGTGTGGAGG + Intronic
921542969 1:216440413-216440435 ATGTTTATTAATTACTATGATGG - Intergenic
1063945307 10:11170313-11170335 CTATTTACTGAGAAGTCTGAGGG - Intronic
1064448928 10:15424309-15424331 ATGTGTATTAAGAAGAATCATGG + Intergenic
1064617522 10:17176799-17176821 CTGTATACTAAGAAATATCAAGG - Intronic
1064960684 10:20961641-20961663 CTGTTTATTCAATAGCATGATGG - Intronic
1065656074 10:27951703-27951725 TTGTTTCTTAAGAACTAGGAAGG - Intronic
1066617884 10:37314272-37314294 CTGTTTATTATGAATTATTTGGG - Intronic
1066683487 10:37958618-37958640 ATGTTTATTAAGAATTAAGGAGG + Intronic
1067879493 10:50031108-50031130 CTGTTTAATAAGAAGCCTCAAGG + Intergenic
1071126136 10:82337086-82337108 CAGTTTAGTAAGAAGTAAAAGGG - Intronic
1072868056 10:99085540-99085562 AAGTTTATGAAGCAGTATGATGG - Intronic
1073086536 10:100894245-100894267 CTGGCTATTAAAAAGAATGACGG + Intergenic
1074888787 10:117717626-117717648 CTGGTCTTTAAGAAGTAAGAGGG + Intergenic
1075082941 10:119396098-119396120 CTGTTTATTATTATTTATGATGG + Intronic
1075295173 10:121268809-121268831 CTGTTTATAAAAAATTCTGATGG - Intergenic
1082301071 11:50507108-50507130 CTGTTTATTAAAATCTATGTAGG - Intergenic
1082594707 11:55062944-55062966 CTGTTTTTTAGAATGTATGAAGG + Intergenic
1085255701 11:75171624-75171646 CTTGTGATTAAGAAGTATGACGG + Intronic
1088071177 11:105787171-105787193 CTGTGTATAAAGAAGTCTAAAGG + Intronic
1090300827 11:125637695-125637717 TTGTTTATTAATAATTATAAAGG + Intronic
1090989606 11:131804249-131804271 CTTTTTATTAGAAAGTGTGAGGG - Intronic
1091401674 12:184953-184975 CATTTCATTAGGAAGTATGACGG - Intergenic
1092756401 12:11767324-11767346 TGGTTTAATAAGAAGTATGAAGG - Intronic
1095190457 12:39251791-39251813 CTGTTGATTTGGAGGTATGAGGG - Intergenic
1095437989 12:42212421-42212443 GTGATTATTTAGAAGCATGATGG - Intronic
1095709426 12:45272616-45272638 GTGTTTATTAAGAACTCTAAGGG - Intronic
1096327758 12:50680702-50680724 CAGTTTATTAAGAAGTGTGTAGG - Exonic
1096432246 12:51556338-51556360 CTGTTTAATAAGCAGTATTCAGG - Intergenic
1097532074 12:60814553-60814575 CTGTTTTATAAGAGGTATGAAGG - Intergenic
1097919505 12:65056524-65056546 CTGTTTATTAAAAAGTAATTGGG - Intronic
1099152388 12:79130867-79130889 ATGTGTGTTAAGAACTATGAAGG - Intronic
1099799830 12:87442993-87443015 AAGTTTATTAAGAAGTAAAATGG + Intergenic
1100157345 12:91816301-91816323 ATGTTTTTTAAGAATAATGAAGG - Intergenic
1100285629 12:93163815-93163837 ATGTATTTTAGGAAGTATGAAGG - Intergenic
1105066235 12:133200802-133200824 CTGGTTATTTAGAAATATGGAGG - Intronic
1105375609 13:19841711-19841733 CTGTTTATACAAAAGTATGTGGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105814795 13:24025008-24025030 CTGTTTCTTAAGATGTATGGGGG - Intronic
1106116964 13:26826168-26826190 GTGTTTATTAAGTAATATCATGG + Intergenic
1107706424 13:43111346-43111368 TTGTTAATTAAAAAGTATGAAGG - Exonic
1108032377 13:46247016-46247038 CTGCTTAATAAAATGTATGAAGG + Intronic
1108836786 13:54560288-54560310 CTATTTATACACAAGTATGAGGG - Intergenic
1109512525 13:63397601-63397623 CTGTTTATTAAAAATAATCATGG + Intergenic
1110149522 13:72233510-72233532 CTTTTTATTTAAAAATATGAGGG - Intergenic
1110536621 13:76658149-76658171 CTGGTTGTTTAGAAGTATGTGGG + Intergenic
1110628172 13:77675270-77675292 CTGTTTAATAGGAATTATAATGG - Intergenic
1111466341 13:88616375-88616397 CAGTGTATTAAGAAAGATGATGG + Intergenic
1114745340 14:25140246-25140268 CTTTTTTTAAACAAGTATGACGG + Intergenic
1115429269 14:33297979-33298001 CTGGTTATTAAGATTTTTGAAGG + Intronic
1116537455 14:46051043-46051065 CTTTTTATTAAAAAGAATGAAGG - Intergenic
1116646577 14:47536419-47536441 CTGTCTATTCTGAAGTATGGAGG + Intronic
1116759205 14:48989956-48989978 ATGTTTATGAAAAACTATGATGG - Intergenic
1117400865 14:55357525-55357547 CTGTTTATTAAGAAGTATGAAGG + Intronic
1117679059 14:58184683-58184705 CTGCTTATCAAGGAGTCTGAGGG + Intronic
1118945818 14:70386335-70386357 CTGTTTATTAATCAGTGAGATGG - Intronic
1119098390 14:71855760-71855782 CTGATTTTTAAAAAGCATGATGG + Intergenic
1120561211 14:85995338-85995360 ATTTTTATTAGGAAGTCTGATGG - Intergenic
1124207907 15:27738885-27738907 ATGTTTATTTAAAAATATGAAGG + Intergenic
1125143809 15:36442009-36442031 CTGTTTAAGAATAAGTATGCAGG - Intergenic
1127411375 15:58710475-58710497 CTGTTTGTAAAGAAATCTGAAGG - Intronic
1127895965 15:63299237-63299259 CTTCTTACTAAGAAGTCTGATGG - Intronic
1128279528 15:66383678-66383700 CTCTATATTAAAAAGTATGGGGG + Intronic
1129058215 15:72837326-72837348 CTGGTTCTTAAGAAGAAGGAAGG + Intergenic
1134417225 16:14054728-14054750 ATGCTTATTAAGTACTATGATGG - Intergenic
1135265606 16:21023085-21023107 ATTTTTTTTAAGAAGTAGGAAGG + Intronic
1135266146 16:21027499-21027521 CATTTTTTTAAGAAGTAGGAAGG - Intronic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1140350630 16:74258766-74258788 TTGCTTGTTAAGCAGTATGATGG + Intergenic
1140678709 16:77362004-77362026 CTGTTTATTAAGGAACATAAGGG + Intronic
1143211111 17:5188444-5188466 CTCTTTATTAAAAAGTACTATGG - Intronic
1145873679 17:28298796-28298818 TTGTTTTTTAAGAAGTATCCGGG - Intergenic
1148850584 17:50552853-50552875 CTGTTTCTTAATAAGTAAAATGG + Intronic
1151009465 17:70476808-70476830 CTTTTTAATAAGAAGTGTGATGG - Intergenic
1151893927 17:76967570-76967592 CTTTTTATAAAGGAGTATCATGG - Intergenic
1152498051 17:80688421-80688443 AGGTTTATCAAGAAGTCTGAAGG + Intronic
1156134486 18:34020840-34020862 CTGATTTTTAAAAATTATGATGG + Intronic
1157790446 18:50526472-50526494 GTGTTTCATAGGAAGTATGAAGG + Intergenic
1158701360 18:59750840-59750862 CTGTCTTTTAAGAAATTTGAAGG + Intergenic
1158705057 18:59784999-59785021 CTGTTTATTAATATGAATGTTGG + Intergenic
1158736265 18:60084903-60084925 CTGTTTATAAGTAAGTGTGAAGG - Intergenic
1158768238 18:60482276-60482298 CTTTTTATTAAAAAGTATATTGG + Intergenic
1159099718 18:63944530-63944552 CTTTTTATAAAGAAGCTTGATGG + Intergenic
1160392342 18:78543672-78543694 CTTTTTCTTAAGGAGTATGAGGG - Intergenic
1161351938 19:3798285-3798307 CTGTTGACTAACAATTATGATGG + Intronic
1165673844 19:37704488-37704510 TGGTTTATTTAGAAGTATGTTGG - Intronic
1168421295 19:56205780-56205802 CTGTTCATTCAGAAGTCTGCAGG - Exonic
1168424159 19:56225158-56225180 CTGTTCATTCAGAAGTCTGGGGG + Exonic
927298467 2:21483186-21483208 CAGTTTATTATGAACTACGATGG - Intergenic
927394671 2:22636166-22636188 ATGTTTAATAAGAAATATGGTGG - Intergenic
929556383 2:42928061-42928083 CTGGTAATTAAGAAGAATCAGGG - Intergenic
931098409 2:58968234-58968256 CAGCTTATTAGGAAGGATGAAGG - Intergenic
931524138 2:63133998-63134020 ATGTTTATTAAGGAGAATGAGGG + Intronic
931891321 2:66675656-66675678 AGGGTTATTAAGAACTATGATGG - Intergenic
933058325 2:77702386-77702408 GTGTTAATTAAGAAGCATGTAGG + Intergenic
933311341 2:80665407-80665429 CTGTGTATTAAGAAGCTGGAGGG + Intergenic
933490056 2:82974540-82974562 CTGATCATGAAGAAGCATGAGGG - Intergenic
935829200 2:106982437-106982459 ATGATTATTAAGCAGTAGGAAGG - Intergenic
939175347 2:138741469-138741491 CTCATTAGTAAGAAATATGAGGG - Intronic
939843680 2:147219164-147219186 CTGTTTATTTATATGTATTATGG - Intergenic
943831017 2:192462277-192462299 ATTTTTATTAAGAAATATTATGG - Intergenic
944276796 2:197848285-197848307 CTGTTTATGAAGAAAAATCAGGG + Intronic
947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG + Intergenic
1170124851 20:12951120-12951142 CTGTTTCTTAAGACAAATGATGG - Intergenic
1170562232 20:17568382-17568404 CTGAATATTAAGAAGTGTAAGGG + Intronic
1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG + Exonic
1178717388 21:34978297-34978319 CTTTCTATTGATAAGTATGAGGG + Intronic
955078220 3:55633816-55633838 GTGTTGATTAAAAAGAATGAAGG - Intronic
957194188 3:77046949-77046971 CTGATAAGTAAGAAGTTTGAAGG + Intronic
958456053 3:94332692-94332714 CAGATTATTATGAATTATGAAGG - Intergenic
958652005 3:96948113-96948135 CTATTTTTAAATAAGTATGAAGG + Intronic
958735857 3:98008771-98008793 CTGTTTTTTATGAAGGTTGATGG - Intronic
960372713 3:116860625-116860647 CTGTTTATCAAGACTTATAAAGG + Intronic
963683931 3:148414203-148414225 GTGTTTAGTAAGAAGAATCAAGG - Intergenic
964934687 3:162068416-162068438 CTGTTAAATAAAAAGAATGAGGG + Intergenic
966410871 3:179644679-179644701 CTGTTTATTTAAAAGTAAGCAGG - Intergenic
967140736 3:186556959-186556981 CAGTTCATTAACAAGCATGATGG + Intronic
968032182 3:195509734-195509756 AAGTTTTTTAAAAAGTATGATGG + Intergenic
968280067 3:197469960-197469982 CTGTTTGTGAAGAAAAATGATGG + Intergenic
969063639 4:4460029-4460051 CAGTTTATAAAGAAGGATTAGGG - Intronic
969389816 4:6883750-6883772 GTGTTTTTAAAGAAGTATAAGGG + Exonic
970305347 4:14725947-14725969 TTGGTGATTAAGAAGAATGAGGG - Intergenic
971001635 4:22329746-22329768 CTGTATTTTCTGAAGTATGAGGG - Intergenic
971100386 4:23459619-23459641 ATGTTTATTAAGATATATGAAGG - Intergenic
971124646 4:23740093-23740115 CTGTTTATAAAATAGTAAGATGG - Intergenic
971615507 4:28785831-28785853 ATGTCTATTATGAATTATGATGG + Intergenic
971882361 4:32393769-32393791 CTGTTTATTAAGAGCCATTAGGG + Intergenic
972449950 4:39187118-39187140 GTGGTTATTAAGATGTATAAAGG + Intronic
972907309 4:43767288-43767310 CAGTATGTTAAGAAGTTTGAAGG - Intergenic
972931891 4:44082316-44082338 CTGTACATTAAGAAATGTGAAGG - Intergenic
972939084 4:44175286-44175308 CAGTTGAATAAGAAGTGTGAAGG + Intronic
972987656 4:44784337-44784359 AAGTTTATCAAGAACTATGAAGG + Intergenic
972996583 4:44886364-44886386 CTGTTTATTCAAATGTATCAAGG - Intergenic
973913418 4:55607827-55607849 CTGTTTATCACTAAATATGAAGG + Intronic
974304997 4:60124867-60124889 GTCTTTATTTAGAAGTTTGATGG - Intergenic
974505653 4:62767659-62767681 CTTTATATTAAGAAATATGGGGG + Intergenic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
975964858 4:79960349-79960371 CTGCTTACTAAGAAGCATTATGG + Intronic
976264379 4:83176340-83176362 CTATTTATGAAGAATTATCAAGG - Intergenic
976525881 4:86087456-86087478 CTGATTTTTAAGAAATCTGAAGG + Intronic
976752512 4:88464370-88464392 CTGGTAATTAAAAAGTATGTTGG - Intronic
976890640 4:90042267-90042289 TTGTTTATTAGGGAGTAGGAAGG - Intergenic
977743118 4:100511246-100511268 CTGTTTCTTAATCAGTAAGATGG + Intronic
977810580 4:101350610-101350632 CTGCTTATCAAGAAATAGGAGGG + Intergenic
980199929 4:129643069-129643091 CTGTATATTAAAAACTATAAAGG + Intergenic
980457451 4:133063880-133063902 CTGTTTTTTAAGAAAGAAGATGG - Intergenic
980705253 4:136484805-136484827 CTGTTCATTTAGAGGTGTGAGGG + Intergenic
983099878 4:163612270-163612292 CTGATAATTTAGAAGTATGCAGG - Intronic
984518583 4:180772721-180772743 CTGTATATTAGAAACTATGAAGG - Intergenic
985220001 4:187694019-187694041 CGGTTAATTAACAAGGATGAAGG - Intergenic
987165424 5:15193352-15193374 CTGTTTATGAAGGAGCAAGAAGG - Intergenic
987208339 5:15651393-15651415 ATTCTTATTAAGAAGTATGTTGG - Intronic
988237144 5:28560616-28560638 ATTTTTATTAACATGTATGAGGG - Intergenic
990412414 5:55554174-55554196 GTCTTTATTTAGAAGTTTGAAGG + Intergenic
990674835 5:58171963-58171985 CTGCTTATTAAGAAGGAAGTCGG - Intergenic
990934256 5:61130391-61130413 CTGTTTCTCAAGAATTTTGATGG - Intronic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
992295926 5:75326723-75326745 CTGTATTTTAAGAAATATAAAGG + Intergenic
992970060 5:82047230-82047252 TTGTTTAATAAAAAGTATGAGGG + Intronic
993514404 5:88812897-88812919 CTGTTTATTGAGCAGTATGCAGG + Intronic
994184005 5:96798712-96798734 ATGGGTATTAAGAAGGATGAGGG - Intronic
994445807 5:99872070-99872092 CTGATTAGAAGGAAGTATGATGG - Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
997124862 5:131215885-131215907 CTGTCTTTTAAAAATTATGATGG + Intergenic
998874208 5:146583026-146583048 CTGATTAGTAAAAAGTAGGAAGG - Intronic
998976030 5:147648936-147648958 CTTTTTCTTCAGGAGTATGAAGG - Intronic
999045568 5:148465448-148465470 CAATTGTTTAAGAAGTATGAAGG + Intronic
999281144 5:150366954-150366976 CTTTTTGTTAAGAAGAATGTTGG - Intronic
999798337 5:155009052-155009074 CTGTTTATTAAAAAATATATTGG - Intergenic
1000382806 5:160644353-160644375 CTGTTTTTTCAGAAGAGTGATGG + Intronic
1000383087 5:160646610-160646632 CTGTTTATTAAGGAGGAGGCTGG + Intronic
1001018907 5:168166015-168166037 CTGTTTATTGATAAATATTAAGG + Intronic
1002956894 6:1874338-1874360 CTTTTTACTAAGGAGTATTAGGG - Intronic
1002985771 6:2189622-2189644 ATGTATATTCAGAACTATGAAGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1008933651 6:56966401-56966423 CTGTTTTTTTATAAATATGAGGG + Intronic
1009857625 6:69284793-69284815 CTCTTTATTAAAAACTTTGAGGG + Intronic
1010065116 6:71673554-71673576 CTGGTCAGTAAAAAGTATGAGGG - Intergenic
1012642171 6:101632395-101632417 CCTATTATTAAGAAGTATTAAGG - Intronic
1013462818 6:110391834-110391856 CAGTTTGTTAAGAAGTATTGGGG - Exonic
1014210803 6:118706028-118706050 CTGCTTCTTAAGAAGTATCACGG + Intronic
1014288042 6:119525483-119525505 CTTTTTATTATCAAGCATGATGG + Intergenic
1015947472 6:138517640-138517662 CTATTTATTAAGAGATATTAAGG + Intronic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1018396413 6:163381204-163381226 ATTTTTATTAAAAAGAATGAGGG + Intergenic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1021063255 7:16140473-16140495 CTGATTTTTAAGAAGTATGGCGG + Intronic
1021488386 7:21191836-21191858 CTGTTTATCAGGAAGTAACATGG - Intergenic
1022683624 7:32573803-32573825 ATGTTTTTTAAGATGTATAAAGG + Intronic
1027362313 7:77422018-77422040 CTGTGTATTAAAAACTATGTTGG - Intergenic
1027475585 7:78627305-78627327 CTGAATATTCAGAAGTATGGTGG - Intronic
1033836680 7:145321854-145321876 CAGGTGTTTAAGAAGTATGAGGG - Intergenic
1033997984 7:147375806-147375828 CTGATTTTTAAAAAGTATAAAGG - Intronic
1034516543 7:151585180-151585202 ATTTTTATTAAGAATTGTGAAGG - Intronic
1037198178 8:16217544-16217566 CTGCTTTTAAAGAAGTATTATGG - Intronic
1037849437 8:22314615-22314637 CTGTTCATTTGGAAGCATGAGGG - Intronic
1039188354 8:34943187-34943209 TTGTTTAGTAAAAAGAATGATGG - Intergenic
1039795250 8:40907407-40907429 GTGTTTTTCAAGAGGTATGAGGG + Intergenic
1041133408 8:54728577-54728599 TTATTTATTAAGAAGAAAGATGG + Intergenic
1041581662 8:59467046-59467068 TTGTTGATTAAGATGTATCATGG + Intergenic
1041785640 8:61630040-61630062 ATGTTTATTAAGCATTATGTAGG - Intronic
1042014139 8:64288038-64288060 CAGTTTATTAAAAAGTAAAAGGG + Intergenic
1042143314 8:65701741-65701763 CTGTTTTTTAAGGAGTGTCAGGG + Intronic
1042506700 8:69568296-69568318 CTGTTTATCTAGAAAGATGAAGG + Intronic
1043085175 8:75821819-75821841 CTATTTATTAAGAGTCATGAGGG - Intergenic
1043264541 8:78247507-78247529 CAGTTTATCAAAAAGTATAATGG - Intergenic
1043875281 8:85479093-85479115 CTGTTAATGAGGAAGTATGGGGG + Intronic
1045803749 8:106132251-106132273 CTGATTATTCACAAGTATAAGGG + Intergenic
1047678811 8:127232508-127232530 CTATCTATCAACAAGTATGATGG + Intergenic
1048458316 8:134598450-134598472 TGGTTTATTAAGAAGAATGAAGG + Intronic
1048896259 8:138995118-138995140 CTGTTTATTCACAGGTATAAAGG + Intergenic
1050127965 9:2379312-2379334 CTATTTGTTAAGAACTGTGAAGG - Intergenic
1050521073 9:6500266-6500288 CTCTTTATTAAAAAGTATGTTGG - Intronic
1051484919 9:17597873-17597895 CTGTTTGTTAAGAAAGATGGAGG - Intronic
1053514061 9:38714740-38714762 CTGTTCATTTAGAAGTGTCAAGG + Intergenic
1056616273 9:88169040-88169062 CATTTTATTAAGAAGTTTTAAGG - Intergenic
1057060729 9:92001951-92001973 CTTTTTGTTAAGAAGTATAAGGG + Intergenic
1058204656 9:102088241-102088263 CTGTTTCTGTAGAAGTATGCAGG + Intergenic
1058637740 9:107052987-107053009 GTGTTTATTAAGATTTAAGAAGG - Intergenic
1058638504 9:107060021-107060043 CTGTTGAGTAAGAAGTGTAAAGG + Intergenic
1058812409 9:108653560-108653582 CTGTATATTGAGAATTATGGTGG - Intergenic
1059025261 9:110620969-110620991 CTGTTTATTAAGAAACAAGCTGG - Intergenic
1060356967 9:122918055-122918077 CTGGCTATAAAGAAGTATGCTGG - Exonic
1060373457 9:123097336-123097358 CAGTTTATTAATAATAATGATGG + Intronic
1185690564 X:2151944-2151966 GTGTTTGTTAAGAAGTATTCTGG + Intergenic
1185690623 X:2152403-2152425 ATGTTTGTTAAGAAGTATTCTGG + Intergenic
1186798339 X:13067792-13067814 CTGTTTATTCTCAAGGATGAAGG + Intergenic
1191266123 X:58395910-58395932 CTGTTTTGTAGAAAGTATGAAGG + Intergenic
1192430573 X:71108838-71108860 CTGTTTCCTAAGATGTAAGATGG - Intronic
1193745774 X:85278680-85278702 ATGTTTTTTAAGAAGTAGGTAGG + Exonic
1195992918 X:110700722-110700744 CTGTTTATTAAAAAGAAATAAGG + Intronic
1197131338 X:123009007-123009029 CTGTTTATTAAGGAATAACAAGG + Intergenic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1202012675 Y:20363191-20363213 TTGATTGTCAAGAAGTATGAGGG - Intergenic