ID: 1117409204

View in Genome Browser
Species Human (GRCh38)
Location 14:55435218-55435240
Sequence AATTATTTCCAGAAATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 2, 2: 3, 3: 60, 4: 654}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117409204 Original CRISPR AATTATTTCCAGAAATTTGA TGG Intronic
901406166 1:9047622-9047644 CATTATTTCCAGACTTTTGGTGG - Exonic
901657179 1:10776123-10776145 ATTTATTTCAAGGAAGTTGAAGG - Intronic
902689675 1:18102520-18102542 AATTCTTTCCAGAATCTTGTAGG - Intergenic
904155562 1:28480042-28480064 AATTATTTGCAAAGATGTGAGGG - Intronic
905112593 1:35607403-35607425 AATTTTTTCCATATATTTGTTGG - Intronic
906247557 1:44287768-44287790 AAGCATTTCCACAAATATGAAGG - Intronic
906358264 1:45128080-45128102 AAATCTTTCCAGAATTTTGATGG - Intronic
906981663 1:50637517-50637539 AATTAATTCCAAAAATTGTATGG - Intronic
908499085 1:64724970-64724992 AATGATCTCCAGAAATTTCTAGG + Intergenic
908575637 1:65456320-65456342 AATTATATCCAGTTAATTGATGG + Intronic
908594245 1:65669126-65669148 ATTTATTCCTAGATATTTGACGG + Intergenic
908677993 1:66627670-66627692 AATTATTTAGAAAAATTTGCAGG - Intronic
909038667 1:70624279-70624301 AATTATTTCATAAAATTTGCAGG + Intergenic
909248195 1:73316898-73316920 AATTATTACCACAAAATTAATGG - Intergenic
909403095 1:75256676-75256698 AAGTATTTCCAGAAAGTAAAAGG + Intronic
909928858 1:81471990-81472012 AGTTATTTACTGTAATTTGAGGG - Intronic
910028302 1:82685081-82685103 AATTATGTACATACATTTGAAGG - Intergenic
910029363 1:82698702-82698724 AAATATTTCGAGAAATAGGAAGG - Intergenic
910312598 1:85841784-85841806 AATTATTTAAAGAAATTGTAAGG - Intronic
910640267 1:89453421-89453443 AGTTATTTCCACAAATGAGATGG - Intergenic
910922735 1:92366813-92366835 ACCTATTTCCAGAAATTGCAGGG - Intronic
911522899 1:98949598-98949620 AATGCTTGCCAGAATTTTGATGG - Intronic
911749145 1:101476283-101476305 AAGTATTACCACAAATTTGGAGG + Intergenic
911937551 1:103998085-103998107 ATATATTTACAGAAATTTGGAGG + Intergenic
911987645 1:104650131-104650153 AATTAATTACAAAAATGTGAGGG - Intergenic
912064289 1:105717736-105717758 AATTATTTTTAAATATTTGAAGG - Intergenic
912313807 1:108648538-108648560 GTTTATTTCCTGAAATTTCAGGG - Exonic
913006015 1:114631891-114631913 AAATATTTTCATAAATTTGAAGG + Intronic
913441527 1:118903386-118903408 AAATATTTGCTGAACTTTGAAGG - Intronic
914577374 1:148987031-148987053 AACTCTTTCCAGAATTTTAATGG + Intronic
914935416 1:151974907-151974929 AATTCTTTCAAGAGATTTGCAGG + Intergenic
915774236 1:158465435-158465457 AGGCATTTCCAGATATTTGATGG - Intergenic
915878147 1:159635086-159635108 AATTCTTCCCAGAAGTCTGAGGG - Intergenic
916642108 1:166741343-166741365 ATTTATTTCCAGTAATAAGATGG - Intergenic
916827481 1:168456415-168456437 AAGTCTCTCCAGTAATTTGAGGG - Intergenic
917014219 1:170511336-170511358 AAATATTTGCAGAAATCAGAGGG - Intergenic
917191521 1:172423494-172423516 AATGTTTTCCAGGTATTTGAAGG - Intronic
917307752 1:173643961-173643983 AAACATTTCTAGAAATGTGAAGG - Intronic
918120753 1:181537526-181537548 AATGATTTCTAGGAATTTGGTGG + Intronic
918650246 1:186953857-186953879 AATTATTTCCAAAGATTTTGGGG - Intronic
918661768 1:187097387-187097409 CATTATTTCCATGAATCTGAAGG + Intergenic
918673201 1:187246849-187246871 AATTCTTTCCAAAAATTGAAGGG - Intergenic
918819266 1:189230331-189230353 ATTTATTTCCACACATTTAAGGG + Intergenic
918914665 1:190619336-190619358 AAATTTTGCCAGACATTTGAAGG - Intergenic
919032456 1:192260514-192260536 CATAATTTCAAGAAAATTGAAGG + Intergenic
919337682 1:196260191-196260213 TATTATTTCCACATATTTGTAGG - Intronic
919468079 1:197946358-197946380 AATTATTTATATAAATTTAAGGG + Intergenic
920000875 1:202797832-202797854 AATTATTTCAGAAAATTTGCAGG - Intronic
920004614 1:202823868-202823890 GATTTTTTCCATATATTTGAAGG - Exonic
920602679 1:207345392-207345414 AATTATTTCCAGAAGTTGTTTGG + Intronic
920754033 1:208710354-208710376 AATTAGATCCAGAAATTTTAGGG - Intergenic
921103593 1:211953328-211953350 AAATGTTTTCAGAAATTTGCAGG - Intronic
921201276 1:212809194-212809216 AGTGGTTTCCAGAATTTTGAGGG + Intronic
921329000 1:214016687-214016709 AATGATTGCCTGAAATTTGAAGG + Intronic
921898693 1:220427703-220427725 AATTGTTTCCAGAGACTAGAAGG + Intergenic
921900368 1:220443804-220443826 ATTTGTTTTTAGAAATTTGAAGG + Intergenic
922135686 1:222823652-222823674 ATTTATTTGCATAAATTTAAGGG - Intergenic
922521019 1:226252415-226252437 AATTATTTCTAGAGGTTTGACGG - Intronic
922521831 1:226259434-226259456 AATTATATCCAGTTAATTGATGG - Intronic
923073841 1:230591667-230591689 CATTCATTCCAGAAATTTGCAGG + Intergenic
923195622 1:231663812-231663834 AATCATTGCCAGAAACTTAAAGG - Intronic
923195917 1:231667156-231667178 AATTATTTCCATTAACTTTAAGG + Intronic
923564551 1:235067240-235067262 AAATATATCCAGTATTTTGAAGG + Intergenic
924143596 1:241050955-241050977 ATTTATTTGCAGATTTTTGATGG + Intronic
924247644 1:242100413-242100435 AATGTTTTCCAGAAATTTTCTGG - Intronic
924351271 1:243116670-243116692 CATTTTTTCCAGAAATCTGGGGG + Intergenic
924409234 1:243785751-243785773 AATACCTTCCAGGAATTTGATGG - Intronic
924837445 1:247666663-247666685 AAATATTTGAAGAAATATGATGG + Intergenic
1063539981 10:6922852-6922874 AATCATTTCCGGAGATTTGAGGG + Intergenic
1064300437 10:14118359-14118381 AAATTTCTGCAGAAATTTGATGG + Intronic
1064446149 10:15395019-15395041 AATTCTTTTCACAAACTTGATGG + Intergenic
1064446661 10:15399584-15399606 AAGGCTTTCCAGATATTTGAAGG - Intergenic
1064644759 10:17449764-17449786 ACTCAGTTCCAGAAATTTGCAGG - Intronic
1064684971 10:17851200-17851222 AATTATTTTAGGAAATTGGATGG + Intronic
1064898000 10:20261294-20261316 ATTTACTTCTAGGAATTTGATGG + Intronic
1064923680 10:20546833-20546855 AATTTCTTCCAGAAATTTCTCGG + Intergenic
1066559424 10:36653001-36653023 AATTATTTCTAGAAACTTCTGGG + Intergenic
1066573835 10:36803211-36803233 TTTTATTTGCAGAAATTTGGAGG - Intergenic
1066993671 10:42541708-42541730 AAACATTTCCAAAAATTAGAAGG + Intergenic
1067364566 10:45613227-45613249 AATTATTAGAAGAAATTGGAGGG + Intergenic
1068053260 10:51979507-51979529 AACTATTTCCAAAAATTGAAAGG - Intronic
1068205663 10:53848636-53848658 TATTTTTTCCTGAGATTTGAAGG - Intronic
1068317244 10:55362582-55362604 AATTATATCCATCAATTTCATGG - Intronic
1068491047 10:57723905-57723927 AATTTTTTCAAGAAGTTTAAAGG + Intergenic
1068778539 10:60894167-60894189 GATTATTTTTAGAAATTTTATGG - Intronic
1069312770 10:67059406-67059428 AATTAATTGCAAAAATTGGAGGG + Intronic
1069385018 10:67876428-67876450 AACTTTTTTCAGAAATTTAAAGG - Intergenic
1070907656 10:80087704-80087726 AATTAGTTCCATACTTTTGAAGG - Intronic
1072056685 10:91765268-91765290 AATTATTTCCATAGATTTAGGGG - Intergenic
1072112895 10:92340115-92340137 AATTGTTGCCAGGAATTTGATGG + Intronic
1072487146 10:95866354-95866376 ATATCTTTCCAGAAATATGAAGG - Exonic
1073046499 10:100642220-100642242 ATTTATTTCCAGAGAGATGATGG + Intergenic
1073194706 10:101680195-101680217 AATAAATTCCAAAAATATGAGGG + Intronic
1077852125 11:6083455-6083477 ATTTCTTTCCAGAACTTTAAGGG - Intergenic
1078828548 11:14955387-14955409 ATTAATTGCCAGAAATTTAAAGG - Intronic
1079081920 11:17419632-17419654 AATTTTTACAAGAAATTTGGAGG + Intronic
1079440633 11:20511086-20511108 TATTTTTTACAGCAATTTGAAGG - Intergenic
1079817524 11:25080578-25080600 GATTATTTTTAGAAATATGAAGG - Exonic
1080258001 11:30313918-30313940 AATTTTTTCCAAAAATTTTCTGG - Intergenic
1080835043 11:35932644-35932666 AAATGTTTCCAGAAATTTGCAGG + Intergenic
1081355249 11:42104792-42104814 AATTTTTTGTAGAATTTTGATGG - Intergenic
1081681181 11:45004864-45004886 AATGATTTTCAGTAAATTGATGG + Intergenic
1081721824 11:45294959-45294981 AATTATTACCACTATTTTGAAGG + Intergenic
1083032834 11:59609964-59609986 AATTATTTCTCAAAATTTTAAGG + Intronic
1084722536 11:70916564-70916586 AATTATTTCCAGAATTCTAATGG + Intronic
1085499159 11:77002635-77002657 AATTTATTCCAGAAAATAGAAGG - Intronic
1085980648 11:81719541-81719563 AAGGCTTTCCAGGAATTTGAAGG - Intergenic
1086600083 11:88622950-88622972 AATTATGTCATAAAATTTGATGG + Intronic
1087006323 11:93475711-93475733 AATTATTTCCAGCTATTCAATGG - Intergenic
1087015618 11:93551888-93551910 AAGTACTTCCTGAAACTTGAAGG + Intergenic
1087142517 11:94778932-94778954 GAGTATTCCCAGAAATTGGATGG + Intronic
1087847084 11:102985649-102985671 TAGTTTTCCCAGAAATTTGAAGG + Intergenic
1087881982 11:103427289-103427311 TATTATTTCAATAAATTTCACGG + Intronic
1087975894 11:104545750-104545772 AATTATTTCCAGAAAATTGAAGG - Intergenic
1087979392 11:104592535-104592557 AAATATTTCAAGAAATATTATGG - Intergenic
1088141613 11:106623663-106623685 ACTCATTTCCAGAAGTTTCATGG - Intergenic
1088318160 11:108528176-108528198 AATTATTTCCACAGATGTGATGG - Exonic
1088965149 11:114712791-114712813 AATTATTTCCAAATAATTCAAGG + Intergenic
1089212735 11:116816990-116817012 ACATATTTCCAGGAATTTCAAGG + Intergenic
1090161966 11:124504971-124504993 AATTAGTTCAACCAATTTGAAGG - Intergenic
1090887642 11:130893233-130893255 TAATATTTGCAGAAATTTGGAGG - Intronic
1091980977 12:4863582-4863604 AATTATTTCCTGAGATTTTCTGG + Intergenic
1092587002 12:9910121-9910143 AATTTTGGCCAGAAAATTGAGGG + Intronic
1093043581 12:14414812-14414834 AGTTATTTCCAGGCATTTGAAGG + Intronic
1093255657 12:16864168-16864190 AATTATTTGCTGAAATTTAAGGG - Intergenic
1093353965 12:18139703-18139725 AATTAGTTCCAGAATTTTCTTGG - Intronic
1093554659 12:20456627-20456649 AATTATTACCAAAAATTCGCTGG + Intronic
1094087071 12:26605820-26605842 AATTATTTTCTGAAATTAAAAGG - Intronic
1094730626 12:33170362-33170384 AACATTTTCCAGAAAATTGAAGG + Intergenic
1094808339 12:34111721-34111743 AAATGTTTACAGAAATTAGAGGG - Intergenic
1095608600 12:44100686-44100708 TATTATTTCTAGAAATTTTATGG - Intronic
1095643574 12:44514125-44514147 ATTTGTTTCCAGAACTTTAAAGG - Intronic
1095792555 12:46183475-46183497 AATTATGAGCACAAATTTGAAGG - Intronic
1096207512 12:49735288-49735310 AAAAATTTCAAGAAATTTAAGGG + Intronic
1096308010 12:50496004-50496026 AATTATTTCCTGATCTTTGGTGG + Intergenic
1096715759 12:53490348-53490370 CTTTAATCCCAGAAATTTGAGGG + Intronic
1096951282 12:55475879-55475901 AATTATTTCCAGGCTTTTAATGG + Intergenic
1098368477 12:69732694-69732716 AATTATTTTCAGAGTTTTCATGG + Intergenic
1098616531 12:72531992-72532014 AATTATTTTGAGAAGTTTGCAGG + Intronic
1099231479 12:80030840-80030862 AATCATGCCCAGAAATTTTATGG - Intergenic
1099321242 12:81152344-81152366 AATAATTTCTAGAAATGTTAGGG - Intronic
1099380837 12:81950645-81950667 AAATATTGCCAGAAGTTTGATGG - Intergenic
1099420112 12:82446915-82446937 ATTTGTTTCAAGAAATTTTAAGG - Intronic
1099448717 12:82783110-82783132 AATAATTTCCTGGACTTTGAGGG + Intronic
1099571742 12:84329727-84329749 AATAATTTCCAGAAATACGAAGG - Intergenic
1099884653 12:88512494-88512516 TATTTTTTCCCCAAATTTGAGGG + Intronic
1099941650 12:89196210-89196232 AATTCTTACCAGAATTTTAAAGG - Intergenic
1100244194 12:92740128-92740150 AATTATTTCAAGAATTTTAGGGG - Intronic
1100285460 12:93161883-93161905 AATTATTTCCTTTAATATGAGGG - Intergenic
1100813419 12:98362639-98362661 AATCATGTCCAGCAATGTGAAGG + Intergenic
1105224914 13:18423458-18423480 ATTATTTTCCACAAATTTGAGGG + Intergenic
1105970071 13:25420759-25420781 AAATATTTCCGGAATATTGATGG + Intronic
1106704728 13:32268226-32268248 AATTATTTGATGAAATTTGGAGG - Intronic
1106981790 13:35293748-35293770 AATTACTTCCAGATTTTTTAAGG + Intronic
1107241860 13:38244963-38244985 AATTATTACCAGAGATTTAGGGG + Intergenic
1107512478 13:41098590-41098612 AAAAATTTCCATACATTTGAGGG + Intergenic
1108120737 13:47183292-47183314 AATAAGTACCACAAATTTGATGG - Intergenic
1108327273 13:49346215-49346237 TATTATGTACATAAATTTGAGGG - Intronic
1108454615 13:50600439-50600461 AATTATTTCCAGGGGTTTGTAGG + Intronic
1109154845 13:58894722-58894744 ATTTTTTTTCAGAAATTTTAGGG + Intergenic
1109790419 13:67240551-67240573 ATTTATTTCCAAGAAGTTGAGGG + Intergenic
1109981294 13:69912019-69912041 AATTATTTTCTGAAATTAGTTGG - Intronic
1110005984 13:70270488-70270510 CATGTGTTCCAGAAATTTGATGG + Intergenic
1110194249 13:72768210-72768232 AACAATTTCCAGAAATCTTAGGG + Intronic
1110364943 13:74672214-74672236 AATTATTTTCACAAAATTGCTGG - Intergenic
1110783801 13:79498875-79498897 AGTCTTTTCCAGAAAATTGAAGG + Intronic
1110948031 13:81448958-81448980 TATTATTTTCATAAATTTGTGGG + Intergenic
1111382460 13:87477021-87477043 TATTATTTTCTGAAAGTTGAAGG + Intergenic
1111627372 13:90806683-90806705 AAATATTTCCATAAACTTTAAGG - Intergenic
1111779524 13:92703985-92704007 AATTTTATCCAGAATTATGATGG - Intronic
1111825165 13:93258521-93258543 ATTTATTTACAGAAACTTGGGGG - Intronic
1111900532 13:94194283-94194305 AATTATGTCCAGATATTGTATGG - Intronic
1112663115 13:101536832-101536854 AATTATTTCCAGAAAATATCTGG + Intronic
1113104731 13:106759690-106759712 TATTAAGTCCAGAAATTTGTTGG + Intergenic
1113410885 13:110088711-110088733 AACTATTTGTATAAATTTGAGGG + Intergenic
1114155881 14:20103082-20103104 AAAAATTTGCAGAAATTTTAAGG - Intergenic
1115035554 14:28852504-28852526 AAATATTTAAAGAAATTTGTTGG - Intergenic
1115058470 14:29160597-29160619 AATCATTTCAAGATACTTGAAGG - Intergenic
1115068086 14:29290071-29290093 AAATATTTCGAGAAAAATGATGG + Intergenic
1115129635 14:30039411-30039433 AATTATTCCCAGTATTATGATGG + Intronic
1115308980 14:31960566-31960588 AATCTGTTCCAGAAATTTGCTGG - Intergenic
1115348509 14:32368050-32368072 TCTTTTTTCTAGAAATTTGAAGG + Intronic
1115429910 14:33304791-33304813 AAATATTTCCAAAAATAGGAAGG - Intronic
1115430357 14:33310367-33310389 CATTATTTCCAGAAAATTACTGG + Intronic
1115519035 14:34214434-34214456 CAATATTTCCAGAAACATGAGGG + Intronic
1115908790 14:38232224-38232246 AATTAGATACAGAAAATTGAGGG + Intergenic
1115949765 14:38707828-38707850 AAGTATTTCTAGATATTTCATGG + Intergenic
1116215217 14:42007949-42007971 AATTCTATCTACAAATTTGAAGG - Intergenic
1116290824 14:43037213-43037235 AAATATTTCCATGAATTAGAAGG + Intergenic
1116371454 14:44138895-44138917 AATTATTTGTATAAATTTAAGGG + Intergenic
1116416648 14:44685629-44685651 ATATATTTCCTAAAATTTGAGGG + Intergenic
1116495254 14:45552602-45552624 AATGCTTTCCAGAAATTCAAAGG + Intergenic
1116680603 14:47964880-47964902 ATTTATTTTCAGAACTTGGAAGG + Intergenic
1117076936 14:52114532-52114554 AACTATTTCTAGAAATTTGGAGG - Intergenic
1117409204 14:55435218-55435240 AATTATTTCCAGAAATTTGATGG + Intronic
1117452798 14:55867094-55867116 AATCTTTTCCAGAAAATAGAAGG - Intergenic
1118362822 14:65070359-65070381 AATTTTTTCCAGTAAATTAAAGG - Intronic
1118409581 14:65464224-65464246 TATTATTTCCAGGAGTTTGTTGG + Intronic
1118431066 14:65719592-65719614 AAGGCTTTCCAGATATTTGAAGG + Intronic
1119647341 14:76357194-76357216 ATCTATATCCAGAAATTTTAAGG + Intronic
1119954320 14:78779604-78779626 AATAATTTCCACAAGTTTGTTGG + Intronic
1120076433 14:80164106-80164128 AATTGTTTCCAGAAGATAGATGG + Intergenic
1120147765 14:80998153-80998175 AATTTCTTTCTGAAATTTGAGGG + Intronic
1120317246 14:82911249-82911271 ACTTGTCTTCAGAAATTTGAGGG - Intergenic
1120496362 14:85241999-85242021 ATTTATTTCTTCAAATTTGAGGG - Intergenic
1120560176 14:85982205-85982227 AAAGAATTACAGAAATTTGAGGG - Intergenic
1122102852 14:99427169-99427191 AATTATTCACAGAAACTTAATGG + Intronic
1125011858 15:34886110-34886132 ATTTATTTCTGGAAATTTGAAGG + Intronic
1125252451 15:37720964-37720986 AATGCTTTCAAGAAATTTGCTGG - Intergenic
1125425248 15:39542265-39542287 AAATATTACCACAAATTTCATGG + Intergenic
1126286391 15:47017556-47017578 AACTATTTCTAGGAACTTGAAGG - Intergenic
1127526783 15:59800706-59800728 AATAATTTACAAAAATTAGATGG + Intergenic
1127946263 15:63757422-63757444 AATTATTTACAAAAATTAGCCGG - Intronic
1129946647 15:79544095-79544117 AATTATTTCCAGAACTTTGATGG - Intergenic
1130086879 15:80784981-80785003 AATTATCTCCAAGAATTTTAAGG - Intronic
1130236364 15:82138240-82138262 AAATATCTCCAGTAATTAGAGGG - Intronic
1130575451 15:85088883-85088905 AATTATTTTCACAAAATTGAGGG - Intronic
1130658261 15:85808623-85808645 AATTTCTTCCAGAAAATAGAAGG + Intergenic
1131671750 15:94627219-94627241 AATTACTCTCAGCAATTTGATGG + Intergenic
1132520360 16:384524-384546 AATAATTTTCAGAAGGTTGAGGG - Intronic
1134586876 16:15419184-15419206 AAACATTTCCAGAAATTTATGGG + Intronic
1135896369 16:26408327-26408349 AATAGTTGCCAGAGATTTGAGGG + Intergenic
1137239866 16:46647049-46647071 AATGACTTCCAGAAATTCCAAGG + Intergenic
1139151950 16:64392724-64392746 AATTATTGCCAGAAATCCTAAGG - Intergenic
1139306299 16:65989098-65989120 TTTTATTTCCAGAAATTCTAAGG - Intergenic
1140384559 16:74523594-74523616 TATTATTAAGAGAAATTTGAAGG - Intronic
1140385738 16:74535872-74535894 AATTAATTTCAGAAATTTAGAGG + Intronic
1140492148 16:75346767-75346789 AATTATTTCCAGAGTTTGGATGG - Intronic
1143072972 17:4312960-4312982 AATTTTTTCTAAAAGTTTGACGG + Intronic
1143638421 17:8180404-8180426 AACTATCTTCAGAACTTTGAAGG - Intergenic
1144155697 17:12498488-12498510 TACTATTTCGACAAATTTGAGGG - Intergenic
1144248161 17:13388142-13388164 CATTTTGTCCAGGAATTTGAGGG - Intergenic
1147618387 17:41845020-41845042 AAATATTTCCAGCAATTCAAAGG + Intronic
1148544607 17:48507926-48507948 AAATATTTTCATAGATTTGAAGG - Intergenic
1150843942 17:68635662-68635684 TATTTTCTCCAGAATTTTGAAGG + Intergenic
1151520030 17:74621520-74621542 AATTATTTCCAGGAACATGCTGG - Intronic
1153031973 18:722461-722483 AATTATATCCTGAAAATAGAGGG + Exonic
1153672257 18:7423044-7423066 TTTTATTTTCAGAAATTTTATGG - Intergenic
1154528449 18:15316064-15316086 ATTATTTTCCACAAATTTGAGGG - Intergenic
1155190600 18:23426293-23426315 AATTATTTCCAAAAACATGATGG + Intronic
1155461339 18:26087987-26088009 AAACATTTCTAGAAATCTGAAGG - Intronic
1155600520 18:27540719-27540741 AATCTTTTCCAGAAATTTACAGG - Intergenic
1155608707 18:27637702-27637724 AATCATTTCCATAAATGTGTGGG + Intergenic
1155761220 18:29569660-29569682 ATTTATTTCCAGCAATTTGAAGG + Intergenic
1155904500 18:31433317-31433339 TATTAGTTCCAGAAATTTTTTGG - Intergenic
1156447254 18:37246676-37246698 ATTTTTTTCTAGAAATTTGGGGG - Intronic
1156899829 18:42287838-42287860 GATTATTGCCTGGAATTTGAAGG + Intergenic
1157461223 18:47896468-47896490 AATTATGTCAAGGAATCTGAAGG - Intronic
1157652556 18:49349319-49349341 ATTTATTTCAAGAAAATTTATGG - Intronic
1157874362 18:51258647-51258669 AATTCTTTCGAGAACTTGGAGGG - Intergenic
1157974284 18:52308683-52308705 AATAATTTCCAGAAGTCTGATGG - Intergenic
1158231872 18:55265571-55265593 AATTGTATCCAGCAATGTGAAGG - Intronic
1159436143 18:68420299-68420321 ATATATTTTCAGAAAATTGAAGG - Intergenic
1159549726 18:69882002-69882024 AATTATTTTCAGAGAATTAAAGG + Intronic
1159998349 18:74990411-74990433 AATCAAATCCAGAAATTTAAGGG - Intronic
1160253759 18:77228706-77228728 AATTAATCTCAGAAATTTGAAGG - Intergenic
1162713997 19:12617477-12617499 TTTTATTTCCAAATATTTGATGG + Intronic
1162839114 19:13342550-13342572 AAATATTTCCAGCAATATGGTGG + Intronic
1164319139 19:24124343-24124365 AATTATTCTCTGAAATTTGAAGG - Intronic
1164511548 19:28901219-28901241 AGTAATTTCCAGGAATCTGATGG + Intergenic
1164547013 19:29174313-29174335 AAGGCTTTCCAGCAATTTGAAGG - Intergenic
1164694740 19:30234909-30234931 CATAATTCCCATAAATTTGAAGG + Intronic
1165957944 19:39513752-39513774 ACTTGTTTTCAGTAATTTGAAGG - Intergenic
1166615986 19:44246953-44246975 GATTATTACCAGAAATAAGAGGG - Intronic
1168018447 19:53592255-53592277 AAATAATTACAGAAATTAGAAGG - Intergenic
925314172 2:2908562-2908584 AATTAGCTCCACAGATTTGAGGG + Intergenic
926332428 2:11836689-11836711 AAGTATTACCAGACACTTGAGGG - Intergenic
926636834 2:15189331-15189353 AATCTTTTCCAGATATTTGTTGG + Intronic
926661189 2:15468946-15468968 AAATAAATACAGAAATTTGATGG - Intronic
926868169 2:17382859-17382881 AATTATTTTCACAAATTAGATGG - Intergenic
926931512 2:18046007-18046029 CATTAGTTCCAGAATTTTAATGG - Intronic
928467976 2:31540994-31541016 AATGACTTCCAGAGATTTAAAGG + Intronic
928535398 2:32235081-32235103 AAATATTTCCTGATATTGGAGGG + Intronic
928844788 2:35657876-35657898 AAATATTTAAAGAAAGTTGATGG - Intergenic
928992745 2:37252114-37252136 AATTATTTTAAGCAGTTTGAGGG - Exonic
929221201 2:39466703-39466725 TAGTATTTTCAGAGATTTGAGGG + Intergenic
929353172 2:40985738-40985760 ATTTATCACCAGAAATTTGAAGG - Intergenic
929361223 2:41093621-41093643 AATTATTTGAAGAAAGTTTATGG - Intergenic
929582631 2:43092551-43092573 ATTTTGTTCCTGAAATTTGAGGG + Intergenic
930385879 2:50694248-50694270 AAAAGATTCCAGAAATTTGAGGG + Intronic
930927607 2:56838359-56838381 AATTATTTCAATACATTTGGAGG - Intergenic
931116091 2:59168421-59168443 TATTATTTGAAAAAATTTGATGG + Intergenic
931161815 2:59701510-59701532 AAGGCTTTCCAGAAATTTGAAGG + Intergenic
931301623 2:60985064-60985086 AATCCTTTTCAGAAATTTAAAGG + Intronic
932144064 2:69303782-69303804 AATTTTTTCCAAAATTTTCAGGG + Intergenic
932443324 2:71752942-71752964 AAATATTTCCAGATATCTGGGGG - Intergenic
932692450 2:73924894-73924916 AATTATTTTTAAAAATTTTATGG - Intergenic
932898463 2:75669087-75669109 AATTATTTTCACATATTTTAAGG + Intronic
933013742 2:77096268-77096290 AGTTTTTTCCAAAATTTTGAAGG - Intronic
933911665 2:86946077-86946099 ATTTATGCCCAAAAATTTGATGG - Intronic
934011331 2:87823818-87823840 ATTTATGCCCAAAAATTTGATGG + Intronic
934124800 2:88877722-88877744 AATAATGTCCAGAATTTAGAAGG - Intergenic
935305686 2:101734044-101734066 AATTATTACCAGACACTTGGGGG - Intronic
935650265 2:105375872-105375894 AAGTATTTTCAGAAATCTGAGGG + Intronic
936126959 2:109796450-109796472 ATTTATGCCCAAAAATTTGATGG - Intronic
936217738 2:110575036-110575058 ATTTATGCCCAAAAATTTGATGG + Intronic
936807199 2:116349191-116349213 AGTTATTTTGAAAAATTTGAAGG + Intergenic
936841270 2:116772677-116772699 AGTAATTTCTAGAAATTTAAAGG + Intergenic
936869381 2:117116252-117116274 GATGATTTCCAGAAATTGGATGG - Intergenic
936956018 2:118023103-118023125 AATTATTTCCTGAGTTTTGGAGG + Intergenic
937620848 2:123983574-123983596 ACTTATTTCCTGAAATTTTAGGG - Intergenic
937756785 2:125549074-125549096 AATTATTTCAAAAAAATCGAAGG + Intergenic
938234425 2:129692650-129692672 AATTATTACTAGAAATTTAAAGG + Intergenic
939037753 2:137152824-137152846 AGCTATTTCCAGAGATTTCAAGG - Intronic
939087724 2:137741717-137741739 AACTACTTCCAGAAATATGTTGG - Intergenic
939339122 2:140870267-140870289 TATAATTTCCAGAAAGGTGAAGG - Intronic
939618118 2:144383314-144383336 ATTTTTTTCAAGTAATTTGAAGG + Intergenic
940092388 2:149934910-149934932 GATTATTTCCACAAACTTGGAGG - Intergenic
940184168 2:150964037-150964059 AATAATTTTCAAAAATTTTAGGG - Intergenic
940242470 2:151578188-151578210 CATCATTTCCAAAAGTTTGAAGG + Intronic
941002453 2:160216340-160216362 GATTATTTCAAGTAATTGGATGG + Intronic
941259436 2:163278158-163278180 AATTATTTCTACAAAATTTAGGG - Intergenic
941544138 2:166826236-166826258 AATAATTTCAATAAATATGAAGG + Intergenic
941745824 2:169086635-169086657 AAGTCTTTCCAGGTATTTGAAGG + Intronic
942211427 2:173674994-173675016 AATTATTTTCAGCCATTTGGAGG - Intergenic
942307364 2:174621908-174621930 ATTTAATTCCACAAATTTCAAGG - Intronic
942539064 2:176996265-176996287 AGATATTTCAAGAGATTTGATGG + Intergenic
942575381 2:177357518-177357540 AATTATTTGTATAAATTTAAGGG - Intronic
943464723 2:188215235-188215257 TATTAGTTCCAGAAATTTCTTGG + Intergenic
943591668 2:189805281-189805303 GACTATTTCCATAAATTTGTTGG - Intronic
943856209 2:192795727-192795749 AATCATTTCAATATATTTGAAGG - Intergenic
944078778 2:195760787-195760809 AAGGCTTTCCAGATATTTGAAGG - Intronic
944395825 2:199264894-199264916 AATTATTTCCCCATATGTGAAGG + Intergenic
945119153 2:206441204-206441226 ATTTATTTACAGAACTTTAATGG - Intergenic
945618975 2:212109408-212109430 AATTGTTTTCAGATATTTGAAGG - Intronic
946463116 2:219887661-219887683 AATTCTTCCCAGAAATTGCAAGG - Intergenic
947306297 2:228751672-228751694 AATTATTTCAAGGAACATGATGG - Intergenic
948306081 2:236947920-236947942 AGTTATTTCCAGAAATGTGAGGG - Intergenic
948339371 2:237237284-237237306 AATTGTTTCCTGATATTTGGAGG - Intergenic
948576252 2:238951859-238951881 ACTTATTTCCAGAGATATGTTGG - Intergenic
1169102696 20:2965280-2965302 ACTTATTTGAAGAAATTTTAAGG - Intronic
1169242689 20:3998000-3998022 AACTACATCCAAAAATTTGAGGG + Intronic
1169515154 20:6308963-6308985 AAATATACCCAGAAATTGGATGG + Intergenic
1169558008 20:6769358-6769380 ACTTGTTTCCAGAAATGCGAGGG + Intronic
1169692116 20:8343549-8343571 AATTATTTTTAGAATTTTAAAGG - Intronic
1170358411 20:15517985-15518007 ATTCATTTCCAGACTTTTGATGG - Intronic
1170795163 20:19540747-19540769 AATTATTTCCAGCAATGGAAAGG + Intronic
1170936784 20:20817429-20817451 AAATTTTCCCAGAAATTTGTTGG - Intergenic
1171057582 20:21922428-21922450 AATTAATTTAAAAAATTTGATGG - Intergenic
1171355559 20:24543172-24543194 AATTAACACCAGAAACTTGATGG + Exonic
1172375243 20:34433745-34433767 AATGATTTTCAGTAATTTGGGGG + Intronic
1173675165 20:44828097-44828119 AATTATTACCAAATATTTGGGGG - Intergenic
1174934047 20:54848154-54848176 AGCTTTTTCCAGAAATTTGAAGG - Intergenic
1176588557 21:8616403-8616425 AATTATATCCAGTTAATTGACGG - Intergenic
1176768964 21:13052476-13052498 ATTATTTTCCAAAAATTTGAGGG + Intergenic
1177046416 21:16175699-16175721 CAGAATTTTCAGAAATTTGAAGG - Intergenic
1177123808 21:17170644-17170666 AATTATTTGTAGAAATTTATAGG + Intergenic
1177543222 21:22522262-22522284 AATTATTTTTAAAAAATTGAAGG - Intergenic
1177841458 21:26238626-26238648 AACTATATACTGAAATTTGACGG + Intergenic
1178050335 21:28739976-28739998 AATTATTGGCTGAAACTTGATGG - Intergenic
1178080600 21:29059964-29059986 AATTACTTCTAGAATTTTGTGGG + Intronic
1178375935 21:32067563-32067585 AATTGTTCCCAGAAGCTTGATGG - Intergenic
1178886306 21:36487426-36487448 GATTATTTCAAGAAATGGGAGGG - Intronic
1180271385 22:10593397-10593419 AATTATATCCAGTTAATTGACGG - Intergenic
1181665304 22:24391370-24391392 ATCTATTTCCAGAAATTTCAGGG + Intronic
1182292901 22:29295295-29295317 CTTTATTTCCAAAATTTTGATGG - Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1183953072 22:41363135-41363157 AATTATTTGCAGAACTGTCAAGG - Intergenic
1184882694 22:47321116-47321138 AGTTATTTCTAGAAATGTGTTGG - Intergenic
949700469 3:6750900-6750922 AATTTTTTCCTGAAATGTTATGG - Intergenic
949971007 3:9404557-9404579 GATTATTTCCATAAATTTGTGGG + Intronic
951078107 3:18422092-18422114 AATTATTTTATGAACTTTGATGG + Intronic
951232712 3:20198449-20198471 GATTTGTTCTAGAAATTTGATGG + Intergenic
951688224 3:25368244-25368266 AATTACTGCAAGAAATATGAAGG + Intronic
951764483 3:26182345-26182367 AATTATTTTCAGTGATTTGGAGG - Intergenic
951768715 3:26230438-26230460 AATTATTTCAAAAAAATTTATGG - Intergenic
952244689 3:31574175-31574197 AAATATTTCCAGAAGTTTCGGGG + Intronic
952585266 3:34885289-34885311 AAATATTTTGAGAAATTTGTTGG + Intergenic
952670807 3:35965831-35965853 AATTATTTCAATAAAATTGCTGG + Intergenic
953083190 3:39640795-39640817 AATCAATCCCAGCAATTTGAGGG - Intergenic
954015708 3:47688495-47688517 AATTATTTCAAGAAGATTGGGGG + Intronic
954809295 3:53238236-53238258 AATTATTTCCAGCAACTGTAGGG + Intronic
955452406 3:59083617-59083639 AAGGCTTTCCTGAAATTTGAAGG - Intergenic
956042255 3:65156706-65156728 AATTAAATCCAGAAATTTCAGGG - Intergenic
956064427 3:65382132-65382154 AATTGTTCCCAGAGATGTGAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956771682 3:72532068-72532090 ACATTTTTCCAGAAATTTGCAGG + Intergenic
957016757 3:75073673-75073695 AGTGATTTTCAGGAATTTGATGG - Intergenic
957112428 3:75981256-75981278 AATTAGTTCCAGCAATTGAATGG - Intronic
957222050 3:77395735-77395757 ATTTATTACCAGAATTTTTAAGG + Intronic
957380131 3:79417067-79417089 AAATATTTCCACAAATATGTTGG + Intronic
957594464 3:82244461-82244483 AATTATTACCAGAATATTGTAGG + Intergenic
958666977 3:97153641-97153663 AATTATTCCCAGAAGTTTTAAGG - Intronic
958856543 3:99392827-99392849 AGGAATTTCCAGAAATTTCAGGG - Intergenic
959041618 3:101428458-101428480 AATTTTTTTCAGAAGTTTGTTGG + Intronic
959208168 3:103340302-103340324 GATTTATTCCAGAATTTTGATGG + Intergenic
959235008 3:103709745-103709767 ATTTATTTCCTACAATTTGAAGG - Intergenic
959361488 3:105399233-105399255 AAATATTTACTGAAATTTGCTGG - Intronic
959577347 3:107948702-107948724 AATTATTTCAAAAGACTTGAAGG - Intergenic
959842655 3:110996307-110996329 AATTAATTTCAATAATTTGATGG - Intergenic
960711114 3:120529280-120529302 AAGTATTGCCAGAGATTTAAAGG - Intergenic
960744264 3:120869062-120869084 AAATAATTCCAGAAACGTGATGG + Intergenic
961567708 3:127775625-127775647 AATTATCTGCAAATATTTGAGGG - Intronic
962038395 3:131678967-131678989 AACTATTTCAAAAAATTGGAGGG - Intronic
962667956 3:137674550-137674572 AAGATTTTCCAGATATTTGAAGG - Intergenic
963060133 3:141219125-141219147 AATAATTCCCAGTAAGTTGAAGG - Intergenic
963553836 3:146760410-146760432 AATTATTGTCAGAAATTTTATGG - Intergenic
964090401 3:152869468-152869490 AATTATATCCAGAAACATAATGG + Intergenic
964859404 3:161184869-161184891 ATTACTTTCCAGAATTTTGAAGG - Intronic
965112262 3:164442722-164442744 GAATATTTCCAGAAATTTTTAGG + Intergenic
965161878 3:165143472-165143494 AAATATTTCAAGCATTTTGAAGG + Intergenic
965433797 3:168621630-168621652 AATTATATCTAGAGATTTCAGGG + Intergenic
965730126 3:171762760-171762782 AATTGTTTTCAGATATCTGAAGG + Intronic
965898333 3:173606677-173606699 AATTATTTGCATTAAATTGAGGG + Intronic
965902327 3:173657501-173657523 AATTATTTGCAGTCATTTTAAGG + Intronic
965918199 3:173877336-173877358 AATAATGGCCAGAAATTTCATGG - Intronic
965946228 3:174245014-174245036 AATTGTTGCTAGAAATTAGAGGG + Intronic
966065272 3:175813992-175814014 TATTTTTTCCAGAAATCTGGTGG - Intergenic
966149708 3:176853829-176853851 AATAATGTCCATAAAGTTGAAGG - Intergenic
966674296 3:182568623-182568645 ATTTATCTCCTGAAATTTTATGG - Intergenic
967110319 3:186287617-186287639 AATTATTTCCAGCATTTAGCTGG - Intronic
967517771 3:190390672-190390694 TATATTTTCCACAAATTTGAAGG + Intronic
968252356 3:197232039-197232061 AATTATTTGCATGAATTTGTTGG - Intronic
968259384 3:197307518-197307540 ATTTGTTTCCAGGAATTTTAGGG - Intergenic
970108021 4:12607037-12607059 AATTTATTTTAGAAATTTGAAGG - Intergenic
970745243 4:19286425-19286447 CATTATTTCAAGATATTTTATGG + Intergenic
971064412 4:23013689-23013711 AATTAATTCCAGAAACCTGTTGG + Intergenic
971071753 4:23102139-23102161 AATAGTTTCCTGAAAATTGAAGG - Intergenic
971291482 4:25345401-25345423 AATAATTTGCAAAAATTTCAGGG - Intronic
971677777 4:29656095-29656117 AATTATTTCTAAATATTTTATGG - Intergenic
971802977 4:31316833-31316855 AATAATTTCCTGAATTTTGATGG - Intergenic
971818272 4:31518396-31518418 AATTACTCTCAGAAATTTTACGG - Intergenic
971867033 4:32185827-32185849 AATATTTTACATAAATTTGAGGG + Intergenic
972476737 4:39457702-39457724 TATTCTTTCCAGAAATATGCAGG + Intronic
972691580 4:41403925-41403947 AATTGATTTCAGACATTTGAGGG + Intronic
972895527 4:43615196-43615218 AATTAGTCCCATAAATCTGAGGG - Intergenic
972928568 4:44041673-44041695 AATGCTTTCCAGGTATTTGAAGG - Intergenic
973115376 4:46451184-46451206 AATTGTGTCCAGAAATTGGCAGG + Intronic
973208919 4:47592931-47592953 AATTAGTACCAGAACTTAGAAGG + Exonic
973783707 4:54315493-54315515 AATTATTCCCATAAGTCTGATGG - Intergenic
974228070 4:59074244-59074266 AATAATTTTCAGAAATTAGGGGG + Intergenic
974243768 4:59286534-59286556 ATTCATTTCAAGAATTTTGAAGG + Intergenic
974264897 4:59573362-59573384 AATTATTTCCTGAATTTCCATGG - Intergenic
974358902 4:60850036-60850058 ATTTTTTTCTAGAAATTGGATGG - Intergenic
974362416 4:60899360-60899382 AGTGATTTCCAGAGGTTTGAAGG - Intergenic
974574784 4:63704152-63704174 AATTATTTTCATAAACTTGTTGG - Intergenic
974755896 4:66206758-66206780 AAATATTTTCAGTAATTTTATGG + Intergenic
974907977 4:68080584-68080606 GATTCTTCCCAGAAATTAGAGGG - Intronic
974977833 4:68913957-68913979 AATTATTTCAAGAGACTTTAGGG - Intergenic
974987435 4:69045536-69045558 AATTATTTCAATAGATTTTAGGG + Intronic
975338742 4:73212308-73212330 AAGTATTTCTAGACATTTAATGG - Intronic
976028803 4:80725429-80725451 AAGTATCTCCAGACATTTGAAGG - Intronic
976102153 4:81576608-81576630 AATGCTTTTCAGATATTTGAAGG - Intronic
977387857 4:96367288-96367310 ATTTATTTCCATTAATTTCAAGG + Intergenic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977485598 4:97639682-97639704 AAGTTTTTCCAGAATTTTTAAGG + Intronic
977715638 4:100180449-100180471 AATCATTTCCTTAAATTTGGAGG - Intergenic
977724541 4:100280213-100280235 AAGCATGTCAAGAAATTTGAGGG + Intergenic
977744197 4:100525697-100525719 ATTTATTTCGAGAAGTTGGATGG - Intronic
978059518 4:104320152-104320174 AATTACTTCTGGAAATTTAAAGG - Intergenic
978249605 4:106614412-106614434 CTTTATTTACAGAAATTTTAGGG - Intergenic
978310468 4:107380904-107380926 AATTTTGGCCAGAAATGTGAGGG - Intergenic
978588256 4:110295719-110295741 AATGATTTTAAGAAATGTGAAGG - Intergenic
978657478 4:111081731-111081753 AATTATTTCTACATATTTGGTGG - Intergenic
979250667 4:118563868-118563890 CATTTTTTCCAGAAATCTGGGGG - Intergenic
980066663 4:128196562-128196584 AATTCTTTCAAAAAAATTGAAGG + Intronic
980697445 4:136378082-136378104 AATTTTTTCCAAAAATTGTATGG + Intergenic
980800934 4:137749500-137749522 ATTCATTTGGAGAAATTTGAGGG - Intergenic
981025354 4:140072226-140072248 AATATTTTCCAAATATTTGAAGG + Intronic
981068989 4:140515082-140515104 AGTTATTTTTAGAAATTTTATGG + Intergenic
981320277 4:143384131-143384153 AATTATTTCTATAATTTAGAAGG - Intronic
981693324 4:147533501-147533523 AATTATTTACAGACATCTCAAGG + Intronic
981811074 4:148775525-148775547 AAATATCTAGAGAAATTTGAAGG - Intergenic
982085610 4:151833244-151833266 AATTCTTACCAGAAAGTTGCTGG + Intergenic
982338625 4:154269652-154269674 ATTTATCTTCAAAAATTTGAAGG + Intronic
982577959 4:157140801-157140823 AATTGTTTTGAGAAATTTGAAGG + Intronic
982633358 4:157861668-157861690 GATTATTTCCAAAATTTTGCAGG - Intergenic
982762613 4:159304511-159304533 ATTTATTCCAAGAAATTTTAAGG + Intronic
983159949 4:164400254-164400276 AAATATTTCCACATATTTCATGG - Intergenic
983261822 4:165465343-165465365 ATTTATTTACAGAAATTGGCTGG - Intronic
983711878 4:170727930-170727952 AATTTTTTTCTGAAATTTGTTGG + Intergenic
983802938 4:171958153-171958175 AATTATTACCAATAATTTCAAGG - Intronic
983902335 4:173148523-173148545 TCTTATTTCTATAAATTTGAAGG - Intergenic
983947500 4:173602880-173602902 AAATATCTCCAGGAATTTGTGGG + Intergenic
984387680 4:179083635-179083657 AATCATTTTCAGATATTTTATGG - Intergenic
984557509 4:181232853-181232875 AATTATTTGCAGAATTTAGTAGG + Intergenic
986425809 5:7630511-7630533 ACAAATTTCCACAAATTTGATGG + Intronic
986631025 5:9774572-9774594 AAGGCTTTCCAGAGATTTGAAGG + Intergenic
987437074 5:17907389-17907411 AAGTTTTTCAAGAATTTTGAAGG - Intergenic
987574880 5:19712280-19712302 TTTTATTTCTATAAATTTGAGGG - Intronic
988011968 5:25500454-25500476 AATTATTGCCAGGAGTTAGAGGG - Intergenic
988060905 5:26169060-26169082 AGCTATTTCCAAAACTTTGATGG + Intergenic
988140833 5:27237668-27237690 TATTATTTCCCAAATTTTGAAGG - Intergenic
988644137 5:33075285-33075307 CATTATATCCAAAAACTTGAAGG + Intergenic
988951951 5:36271746-36271768 AATTATTTCTGGATATTTTAAGG - Intronic
989429723 5:41338709-41338731 AATTATTTTCAAATATTTAAAGG - Intronic
990021958 5:51138661-51138683 AATTATTGAAAGGAATTTGAAGG + Intergenic
990095926 5:52112738-52112760 ATTTGTTTCCAGAAATTTGGTGG + Intergenic
990591800 5:57273142-57273164 AATTCTTTCCAACAATTTAATGG - Intergenic
990674168 5:58164736-58164758 AATGATTTCCAGGAATTTAGGGG + Intergenic
990793038 5:59504338-59504360 TATTATTTTGAGTAATTTGAAGG + Intronic
991065235 5:62417263-62417285 AATTCTTTCAAGAAACTTAAAGG - Intronic
991181813 5:63760740-63760762 ATTTATTTTCAGGAATTAGAAGG + Intergenic
991972447 5:72154196-72154218 TACTATTTCTAGAAATCTGAGGG - Intronic
992129549 5:73677785-73677807 AAGTATTTCCAAACATTTGCTGG - Intronic
992475006 5:77093317-77093339 TATTTTTTCCAGGAATTTGTTGG + Intergenic
993010302 5:82474911-82474933 AATTATATGCAAATATTTGAAGG - Intergenic
993248272 5:85480450-85480472 AATACTTTCCAGAACTTTGATGG + Intergenic
993776049 5:91997950-91997972 AAATATTTTCACAAATTAGAAGG - Intergenic
993961210 5:94298468-94298490 AAAAATGCCCAGAAATTTGAAGG + Intronic
993981408 5:94546693-94546715 AATGCTTTCCAGGTATTTGAAGG - Intronic
994227349 5:97268278-97268300 AATTATTTTTAAGAATTTGAAGG + Intergenic
994372695 5:98985263-98985285 AAATATTTAGAGAAATTTTAGGG + Intergenic
994867316 5:105292732-105292754 GATTATTTCCAGATAGTTAAGGG - Intergenic
994868594 5:105314125-105314147 TATTATTTCCACAAGTTTGCAGG - Intergenic
994939729 5:106307033-106307055 AATTATTTTCTGAATTTTGGGGG + Intergenic
994952138 5:106477114-106477136 AATTGTTTCCCCAAATTTAAAGG - Intergenic
995102329 5:108327766-108327788 AATTATTGCCAGAGCTTTGTTGG - Intronic
995129060 5:108610564-108610586 AATTATTAACAGAAATATTAGGG + Intergenic
995552944 5:113298478-113298500 AATTCTTTCCATAAATTTGATGG + Intronic
995805295 5:116045457-116045479 AATTATTTCTTGCAATTTTAAGG - Intronic
996071232 5:119134377-119134399 CATTACTTACAGAAATTTCAGGG - Exonic
996260839 5:121466372-121466394 AATTATTTGCAAAAACTTTAAGG + Intergenic
996302547 5:122006837-122006859 AATTATTTTCAGAAAGCTTAAGG - Intronic
996429590 5:123357879-123357901 AATTATTGGCAAAAATGTGAAGG + Intronic
996436394 5:123437545-123437567 AAATATTTCAATAAATTTAAAGG + Intergenic
996635387 5:125682679-125682701 GATTATTTCCAAAAATATAATGG - Intergenic
996797179 5:127361083-127361105 AACTTATTCCAGAAAATTGAAGG - Intronic
997516865 5:134496116-134496138 AATTATTTCCATCAGTTTGAAGG - Intergenic
997972516 5:138415301-138415323 AATCATTTCAAAAAATTTTATGG - Intronic
998439229 5:142142521-142142543 AATAATTTAAAGAAATTTAATGG + Intronic
998698223 5:144665787-144665809 AGATATTTTCAGATATTTGAAGG + Intergenic
999703789 5:154252737-154252759 AAAAATTTCCTGAAATTTAAGGG - Intronic
1000494196 5:161957874-161957896 ATTTATTTTCAGAAATTTACAGG + Intergenic
1000864578 5:166497093-166497115 AATCATTTCCAGCAATGTTATGG + Intergenic
1001134785 5:169093333-169093355 AATCAGTTCCAGAATTTTGCTGG - Intronic
1003424813 6:5991672-5991694 ACAAATTTCCACAAATTTGATGG + Intergenic
1003477086 6:6493128-6493150 TTTTTTTTCCAGAAATTTGGGGG - Intergenic
1003776171 6:9368099-9368121 ATTTATTCCAAGAAAATTGAAGG + Intergenic
1005118872 6:22368810-22368832 AACTTTCTCCAGACATTTGAGGG + Intergenic
1006426681 6:33967719-33967741 GATTAGTTCCAGAAGTTAGAGGG - Intergenic
1006710433 6:36064351-36064373 AACTATTTCCTCAAATTTCATGG + Intronic
1008006167 6:46411813-46411835 AATTATGTGCAGAAATGTAATGG + Intronic
1008116331 6:47554697-47554719 AATTCTTTCACAAAATTTGAGGG - Exonic
1008316094 6:50043161-50043183 AATCGTTGCAAGAAATTTGAAGG - Intergenic
1008458918 6:51744850-51744872 AATTATTTTTAGGAATTTCAGGG + Intronic
1008485369 6:52029631-52029653 ATTTATTTCTAGAAATTTCACGG + Intronic
1008551292 6:52634016-52634038 ACATTTTTCTAGAAATTTGAAGG + Intergenic
1008745057 6:54659514-54659536 AATTATTTCCATTAATGTGCCGG + Intergenic
1009310197 6:62140459-62140481 AATAAATTCTATAAATTTGAGGG + Intronic
1009799301 6:68513705-68513727 AAATATTTCTGGGAATTTGAGGG - Intergenic
1009804126 6:68580146-68580168 AATTATTTCCTGACATCTGAAGG - Intergenic
1010525741 6:76898436-76898458 AATTATTTCAAGAAGATTGTGGG + Intergenic
1010676788 6:78754501-78754523 AATTATTTCCATGAATTCAAAGG - Intergenic
1010719551 6:79267166-79267188 AACTATTTTCAGATATATGATGG - Intergenic
1010814954 6:80347084-80347106 TATTTTTACCAGCAATTTGAAGG + Intergenic
1010910613 6:81550668-81550690 ATTTATTATTAGAAATTTGAGGG - Intronic
1011019101 6:82790269-82790291 AAGGCTTTCCAGATATTTGAAGG - Intergenic
1011122713 6:83971604-83971626 AAAAATTTCCAGAACTTTTATGG - Intergenic
1011179877 6:84608416-84608438 AATTATGTTGAGAAATGTGAGGG + Intergenic
1011497359 6:87949840-87949862 AATAATGTCACGAAATTTGAGGG + Intergenic
1011695115 6:89905485-89905507 AATTATATCCAGTTAATTGATGG + Intergenic
1011905212 6:92357512-92357534 TATTATTTTTAGAAATGTGATGG + Intergenic
1012013003 6:93815382-93815404 AATTATTTGTATAAATTTAATGG - Intergenic
1012074335 6:94665350-94665372 AATTATGTTGACAAATTTGAGGG - Intergenic
1012099196 6:95009217-95009239 AAATATTTCCAGTAATTTCTTGG + Intergenic
1012160625 6:95880740-95880762 ATTTATTTAGAGGAATTTGAAGG + Intergenic
1012368014 6:98466115-98466137 GATTATTTCAAGAAATTCAATGG + Intergenic
1012571860 6:100739479-100739501 AACTATTTCAAAAAATTTAAAGG - Intronic
1012749349 6:103138530-103138552 AATTATTGCCAGGAAATAGAAGG + Intergenic
1012958044 6:105591957-105591979 AATTATTTCTATTAATGTGATGG - Intergenic
1012963812 6:105651159-105651181 AAATATTTCAATACATTTGAGGG + Intergenic
1013856070 6:114573808-114573830 TATTATTTGCATAAATTTAAGGG - Intergenic
1013897553 6:115108237-115108259 AATTATTTGAAAAAATTTGGGGG + Intergenic
1014072275 6:117196644-117196666 AAGTATTTCCAGACTTTTTATGG - Intergenic
1014319540 6:119909461-119909483 AAATATTTCTAGAAATGTGGTGG - Intergenic
1014501191 6:122191502-122191524 AGTTATTTTCAGAAATTTATTGG - Intergenic
1014596923 6:123355851-123355873 ATTTATTTCAAGATATTTTATGG + Intronic
1014857560 6:126420589-126420611 AATTATCTGCAGATATTTGCTGG + Intergenic
1014964274 6:127727706-127727728 ATTTATATACAGTAATTTGAAGG - Intronic
1015073137 6:129122185-129122207 AATTATTACCAGAATATTGAAGG + Intronic
1015998533 6:139019141-139019163 CATTATTTCTAGAATTTTCATGG - Intergenic
1016230852 6:141802097-141802119 AATGATTTCCAGCAGTTAGAGGG + Intergenic
1016429791 6:143971030-143971052 AATTACTTCCAGAAACTGGGAGG + Intronic
1016958762 6:149651818-149651840 AATAATTTCAAAGAATTTGAGGG + Intergenic
1017305861 6:152917529-152917551 AATTATTTCCATAAGTTTTTGGG - Intergenic
1018728218 6:166629385-166629407 CATTAGTTCCCCAAATTTGAAGG + Intronic
1019044524 6:169132813-169132835 AAGGATTTCCAGGGATTTGAAGG - Intergenic
1019227732 6:170528675-170528697 AACTGTTTACAGCAATTTGATGG - Intergenic
1020369889 7:7420436-7420458 AACTATTACCAGAAAATTGGTGG + Intronic
1020591937 7:10150289-10150311 AATTATTTCTAAAAATTTTGTGG + Intergenic
1020725557 7:11809212-11809234 AATCATTACCAGTAATTTGGTGG + Intronic
1020898563 7:13973784-13973806 AAATATTTTCAGAATTGTGAAGG - Intronic
1021048970 7:15958499-15958521 ATTTCTTTTCAGAATTTTGAAGG - Intergenic
1021050495 7:15977905-15977927 AAATATTACCAGAAATGTGCTGG - Intergenic
1021061043 7:16112476-16112498 AATTTTTTCTTTAAATTTGAAGG - Intronic
1021088979 7:16458697-16458719 AATTTTATTCAGAAATTTGGAGG + Intergenic
1021734719 7:23631890-23631912 AATCTTTTCCAGAAAATAGAAGG + Intronic
1022012136 7:26317577-26317599 AATTATTCCCAGGTATTTGGTGG - Intronic
1022394288 7:29971922-29971944 AATTATTTTCAGAATTGTGGGGG - Intronic
1022664244 7:32395361-32395383 AAAGATTTCCAGAAAGATGAGGG + Intergenic
1022899769 7:34794806-34794828 AATTATTTTTATAAATTTGTTGG - Intronic
1023083753 7:36549599-36549621 AATTATTTCCATCAATGTGTTGG - Intronic
1023120932 7:36907645-36907667 AATGGTTTCCAGAAATCTGCTGG + Intronic
1023387362 7:39673202-39673224 AATTATCTTCACAAATTTTATGG + Intronic
1024973163 7:55088947-55088969 AATGATTTCAGGAAATTAGAGGG + Intronic
1025118650 7:56280238-56280260 ATGTTTCTCCAGAAATTTGAGGG - Intergenic
1026515457 7:71066798-71066820 AATTATTTACAGAACATTTAAGG + Intergenic
1026571267 7:71533391-71533413 AATTACTTCCTGAAATCTCAAGG - Intronic
1027483642 7:78731437-78731459 ATTCATTACCAGACATTTGAAGG + Intronic
1027491766 7:78835784-78835806 AATTATTTCCATAAATAAAATGG - Intronic
1027552664 7:79618776-79618798 ACTTATTTCCAGGAATTATAGGG + Intergenic
1027648723 7:80838083-80838105 CATGATTTTCTGAAATTTGATGG - Intronic
1027709790 7:81585528-81585550 AAATTTTTCCAAAAAGTTGATGG + Intergenic
1027990483 7:85353778-85353800 AAATATTTTCAAATATTTGAAGG + Intergenic
1028083631 7:86608601-86608623 AATAAATTCAAGAACTTTGATGG + Intergenic
1028271964 7:88802614-88802636 AATTATTTTCTTAAATTTGATGG - Intronic
1029007773 7:97228610-97228632 AATTATTTCCACAAATGGAAAGG - Intergenic
1029942275 7:104493024-104493046 TATTCTTTTCAGAAATTTGAAGG - Intronic
1030643305 7:112030530-112030552 ATTTATTTCCTGTAGTTTGAGGG + Intronic
1030647289 7:112076158-112076180 AATCATTTGCAGTAATTTGAAGG + Intronic
1030778605 7:113568562-113568584 AATAATTTCAGAAAATTTGATGG + Intergenic
1030847192 7:114434559-114434581 AATTATTGAAAGAACTTTGAGGG + Intronic
1030886448 7:114944345-114944367 AAATATTTCCAAATATTTGTGGG + Intronic
1032372301 7:131369380-131369402 AATTAATTTCATCAATTTGATGG + Intronic
1032677715 7:134146779-134146801 AATAATCTCCATAAATTTGGGGG + Intronic
1032709865 7:134452118-134452140 AAATATTTTGAGATATTTGAAGG - Intronic
1033284790 7:140031818-140031840 AATGACTTCCAGAAATAGGAGGG + Intronic
1033335981 7:140452687-140452709 AATTATTTCGTGAATTTTTAAGG - Intergenic
1033378306 7:140786701-140786723 AAACACTTCCAGAAAGTTGAAGG + Intronic
1033859668 7:145608957-145608979 AAGTATTTCCAGAATTCTGAAGG + Intergenic
1034106167 7:148491941-148491963 AATTCTCTTCAGAAATTTGATGG + Intergenic
1034126557 7:148676556-148676578 AAGGCTTTCCAGACATTTGAAGG - Intergenic
1034225795 7:149480299-149480321 AATTATTTACAGAAATAAAAAGG + Intronic
1034404409 7:150892501-150892523 ACTTATTGCCAGAAGCTTGAAGG + Intergenic
1036030596 8:4966831-4966853 AATTAACTTCAGTAATTTGAAGG - Intronic
1036126115 8:6064054-6064076 AATTATTTACAGGAATCTCATGG - Intergenic
1037022832 8:13995203-13995225 CTTTATTTCTAGAAAATTGAAGG - Intergenic
1037120890 8:15285442-15285464 TATTATTTTTAAAAATTTGAAGG - Intergenic
1037919461 8:22794707-22794729 TTTTATTTACAGAAGTTTGAAGG + Intronic
1038246005 8:25857039-25857061 AAGAATTTCCAAAAATTTGGGGG + Intronic
1038379932 8:27083394-27083416 AAATATTTGCAGAATGTTGAAGG - Intergenic
1038602820 8:28964591-28964613 AAGTATTTTCTAAAATTTGATGG + Intronic
1039233350 8:35473850-35473872 ATTTATTAACAGAAATTTGTTGG + Intronic
1039743197 8:40400670-40400692 AATTGTTTGCATAAATTTAAGGG + Intergenic
1040794355 8:51272606-51272628 AATTTTTTTCAGCAATTTCAGGG - Intergenic
1040828845 8:51654813-51654835 CATTATTTCCAGAAGCTTGAAGG + Intronic
1041618478 8:59935794-59935816 AATTATTTTTATATATTTGAGGG - Intergenic
1041892323 8:62883434-62883456 TATTATTTCCAGGAGTTTTATGG + Intronic
1042001782 8:64131397-64131419 AATTATGACCAGCAATTGGAAGG + Intergenic
1042120117 8:65478176-65478198 AATTATTCACACAAATTTTAAGG + Intergenic
1042552028 8:70002738-70002760 AATTATTTCTAGTAAATTTATGG - Intergenic
1042646228 8:70989248-70989270 AATTATTTGCAAAAATTTTATGG + Intergenic
1042716674 8:71780782-71780804 AATAATTACCAGCAATTTCAGGG - Intergenic
1042803003 8:72741426-72741448 TATTATTTCAATAGATTTGAAGG + Intronic
1043253021 8:78099979-78100001 AATTATTTCTACATATTTAAGGG - Intergenic
1043267902 8:78289524-78289546 ATTTATTTCCAGAACAATGAGGG + Intergenic
1043671655 8:82894034-82894056 AATTTATTCCACAAATTAGATGG - Intergenic
1043994893 8:86801014-86801036 TATTCTTTCCACAATTTTGATGG + Intergenic
1044393114 8:91676418-91676440 AATTAATTCCAGAACTCTCATGG - Intergenic
1044395087 8:91702232-91702254 AAGGCTTTCCAGACATTTGAAGG + Intergenic
1045337288 8:101218437-101218459 AAACCTTTCCAGAAATTTGAAGG + Intergenic
1045423838 8:102043375-102043397 AATTGTTTCCATAGAGTTGACGG + Intronic
1045590090 8:103583279-103583301 AAGGCTTTCCAGATATTTGAAGG - Intronic
1046049451 8:109004379-109004401 AATTCTTTTCAGAAATATTACGG - Intergenic
1046333531 8:112753423-112753445 CATTCTTTCCAGAAATAGGAAGG - Intronic
1046537719 8:115536859-115536881 AAATATTAACATAAATTTGAAGG + Intronic
1046681390 8:117174301-117174323 TATTTTTTTCTGAAATTTGAGGG + Intronic
1047985697 8:130230980-130231002 AAGTATTTCCTCAAACTTGAAGG - Intronic
1048419787 8:134266763-134266785 AATCATTTCCTTAAGTTTGATGG + Intergenic
1049078446 8:140419990-140420012 AATGAGTTCCACAAATTTGAAGG + Intronic
1050044719 9:1530898-1530920 AATTAGTTCCAGAGATCTGCTGG + Intergenic
1050194702 9:3069378-3069400 AATTACAACCCGAAATTTGATGG + Intergenic
1050207371 9:3211400-3211422 AATGATTGACAGAAATTTGCTGG - Intergenic
1050392322 9:5157690-5157712 AAGTCTTTCCAGTTATTTGAAGG - Intronic
1050404370 9:5292663-5292685 AATTGTTTACAGACATTTGATGG + Intergenic
1050612073 9:7363171-7363193 AATTATGTCTACAAATTAGAAGG + Intergenic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1050936668 9:11405394-11405416 AATTATTTTGAGAAATGTGAAGG + Intergenic
1050955612 9:11654221-11654243 AATTATTTCAAAAAATGTGTGGG - Intergenic
1051163850 9:14239758-14239780 AATTATTTTCAGAATATTGGAGG + Intronic
1051832612 9:21297143-21297165 AATTATTTTCACAAAATTGCTGG + Intergenic
1051956350 9:22699830-22699852 AACTATTTCCAAATATGTGAAGG + Intergenic
1052186802 9:25607416-25607438 AATTTTTACAAGAAATGTGAAGG - Intergenic
1052502942 9:29316385-29316407 AATTATTTGGAGTAATTTTAGGG - Intergenic
1052771956 9:32698085-32698107 AATTATTCCCAGAGATTTGGAGG + Intergenic
1055228415 9:74030103-74030125 AATTATTGCTACAAATTTAAAGG - Intergenic
1056291786 9:85150770-85150792 AATGCTTTTCTGAAATTTGAAGG - Intergenic
1057320854 9:94011167-94011189 AAGTACTTCCAGAAATGTCAGGG + Intergenic
1057344073 9:94232196-94232218 AATTGTTTCTAAAAACTTGAAGG + Intergenic
1057522902 9:95774170-95774192 AATTATTTTAAGGAATTTGAGGG + Intergenic
1058316892 9:103580176-103580198 AATTTTTTCTAGAATTTTCAAGG + Intergenic
1058737598 9:107908301-107908323 AATTATTACCATAAATTTAGTGG + Intergenic
1059222788 9:112641155-112641177 AATTAGTTACAGATATTTGCCGG - Intronic
1059809510 9:117840125-117840147 GATTATTGCCAGCAAGTTGAGGG - Intergenic
1060168016 9:121436054-121436076 AATAATATCCTGAAAGTTGAAGG - Intergenic
1203618563 Un_KI270749v1:94965-94987 AATTATATCCAGTTAATTGATGG - Intergenic
1203654816 Un_KI270752v1:13390-13412 AAATATTGCCAAAAATTTGGTGG + Intergenic
1187584784 X:20648256-20648278 AATAATTTCCAGAAATCTTTTGG - Intergenic
1188079988 X:25827128-25827150 AACTATTTCCAGTAACTTAATGG + Intergenic
1188420987 X:29990991-29991013 AAGTCTTTCCAGGTATTTGAAGG + Intergenic
1188575966 X:31650396-31650418 GATTATTTCCAAAAATTTAAAGG - Intronic
1188622115 X:32238695-32238717 AATTATTCCTAGAAGTTTAAAGG + Intronic
1189014460 X:37081999-37082021 AACTACTTCAAGAAATATGAAGG + Intergenic
1189461328 X:41245363-41245385 TCTTATTTCCACAAATTTGGGGG - Intergenic
1189732558 X:44036779-44036801 AATTCTCCCTAGAAATTTGATGG - Intergenic
1189882893 X:45510520-45510542 ACTTATTTCCAGAGATTTCCTGG + Intergenic
1192747465 X:73953737-73953759 CATTAGTTCTAGAAATTTGGGGG - Intergenic
1193186729 X:78522250-78522272 AAGTCTTTCAAGAAGTTTGATGG + Intergenic
1193441174 X:81540293-81540315 AAGGATTTCCAGGTATTTGAAGG - Intergenic
1193804580 X:85979321-85979343 ATTTATTTTCAGATCTTTGAAGG + Intronic
1193883684 X:86959260-86959282 AATTGTTTCCTGAAATAAGATGG - Intergenic
1194425796 X:93736329-93736351 AATTATTTCAAAAACTTAGAAGG - Intergenic
1194589686 X:95784282-95784304 AAATATTTTCAAAAATTTCAGGG + Intergenic
1195530306 X:105946476-105946498 AATAATTTCTAGGAATCTGAAGG - Intronic
1196045556 X:111252639-111252661 AATTATATTCAGAAATTTCTAGG + Intronic
1196096600 X:111807715-111807737 AAGGCTTTCCAGATATTTGAAGG + Intronic
1196516015 X:116612659-116612681 ATTTATTTACAGATAGTTGATGG - Intergenic
1196712478 X:118777351-118777373 ATTTATTTTTAAAAATTTGAAGG + Intronic
1197171709 X:123442349-123442371 AATTGTCTTCAAAAATTTGAAGG + Intronic
1197851209 X:130862349-130862371 AATTATTTGGAGGAATTTGGAGG - Intronic
1198596309 X:138239862-138239884 AATTATTTGTATAAATTTAAAGG - Intergenic
1198649853 X:138850491-138850513 AATTAATGCCAGAAATCTGGTGG - Intronic
1198719557 X:139601447-139601469 AATTATACTCAGAATTTTGAAGG - Intronic
1199208663 X:145180263-145180285 AATCATTTCCAGCAATTTAGGGG + Intergenic
1199328185 X:146526654-146526676 AATTATTTTCATAAAATTAAGGG - Intergenic
1201404807 Y:13638856-13638878 AATTTTATACAGAAAGTTGAAGG + Intergenic
1201766601 Y:17578837-17578859 AATTAATTGCAGTAATTTCAAGG + Intergenic
1201834951 Y:18327147-18327169 AATTAATTGCAGTAATTTCAAGG - Intergenic