ID: 1117413390

View in Genome Browser
Species Human (GRCh38)
Location 14:55471003-55471025
Sequence TTGGACACACAGACCAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117413388_1117413390 20 Left 1117413388 14:55470960-55470982 CCTGATTTGGACATGACAGCATT No data
Right 1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117413390 Original CRISPR TTGGACACACAGACCAATCT TGG Intergenic
No off target data available for this crispr