ID: 1117414261

View in Genome Browser
Species Human (GRCh38)
Location 14:55479251-55479273
Sequence GGATGCAGGATAGCAGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117414261_1117414267 0 Left 1117414261 14:55479251-55479273 CCCCTTGCTGCTATCCTGCATCC No data
Right 1117414267 14:55479274-55479296 AGGCCAACTACTCATGTGCCTGG No data
1117414261_1117414270 9 Left 1117414261 14:55479251-55479273 CCCCTTGCTGCTATCCTGCATCC No data
Right 1117414270 14:55479283-55479305 ACTCATGTGCCTGGGAGTTCTGG No data
1117414261_1117414268 1 Left 1117414261 14:55479251-55479273 CCCCTTGCTGCTATCCTGCATCC No data
Right 1117414268 14:55479275-55479297 GGCCAACTACTCATGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117414261 Original CRISPR GGATGCAGGATAGCAGCAAG GGG (reversed) Intergenic
No off target data available for this crispr