ID: 1117414340

View in Genome Browser
Species Human (GRCh38)
Location 14:55479931-55479953
Sequence CTATGGGAGGGGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117414340_1117414348 -9 Left 1117414340 14:55479931-55479953 CCCTCTCCCCTCCCCTCCCATAG No data
Right 1117414348 14:55479945-55479967 CTCCCATAGACTATCCCCTGAGG No data
1117414340_1117414351 0 Left 1117414340 14:55479931-55479953 CCCTCTCCCCTCCCCTCCCATAG No data
Right 1117414351 14:55479954-55479976 ACTATCCCCTGAGGTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117414340 Original CRISPR CTATGGGAGGGGAGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr