ID: 1117416420

View in Genome Browser
Species Human (GRCh38)
Location 14:55500668-55500690
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117416420_1117416427 23 Left 1117416420 14:55500668-55500690 CCACAATCCTTCACTTTACCCTG No data
Right 1117416427 14:55500714-55500736 TTTTGCAGCTTCTCCTACTAAGG No data
1117416420_1117416428 26 Left 1117416420 14:55500668-55500690 CCACAATCCTTCACTTTACCCTG No data
Right 1117416428 14:55500717-55500739 TGCAGCTTCTCCTACTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117416420 Original CRISPR CAGGGTAAAGTGAAGGATTG TGG (reversed) Intergenic
No off target data available for this crispr