ID: 1117418314

View in Genome Browser
Species Human (GRCh38)
Location 14:55518803-55518825
Sequence GTATGTACAGAGATTTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117418314_1117418324 11 Left 1117418314 14:55518803-55518825 CCCAGATAAATCTCTGTACATAC No data
Right 1117418324 14:55518837-55518859 AGGGAACTCGCTGCCTTGAAGGG No data
1117418314_1117418323 10 Left 1117418314 14:55518803-55518825 CCCAGATAAATCTCTGTACATAC No data
Right 1117418323 14:55518836-55518858 AAGGGAACTCGCTGCCTTGAAGG No data
1117418314_1117418326 27 Left 1117418314 14:55518803-55518825 CCCAGATAAATCTCTGTACATAC No data
Right 1117418326 14:55518853-55518875 TGAAGGGAAAGACCCAGTCCTGG 0: 15
1: 137
2: 401
3: 704
4: 1225
1117418314_1117418319 -8 Left 1117418314 14:55518803-55518825 CCCAGATAAATCTCTGTACATAC No data
Right 1117418319 14:55518818-55518840 GTACATACCCAGGGCCAGAAGGG No data
1117418314_1117418318 -9 Left 1117418314 14:55518803-55518825 CCCAGATAAATCTCTGTACATAC No data
Right 1117418318 14:55518817-55518839 TGTACATACCCAGGGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117418314 Original CRISPR GTATGTACAGAGATTTATCT GGG (reversed) Intergenic
No off target data available for this crispr