ID: 1117422640

View in Genome Browser
Species Human (GRCh38)
Location 14:55562101-55562123
Sequence ATTGAGTAGGCTAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 7, 2: 34, 3: 97, 4: 875}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117422635_1117422640 -8 Left 1117422635 14:55562086-55562108 CCTCACCTTCTTCATATTGAGTA 0: 1
1: 0
2: 17
3: 126
4: 504
Right 1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG 0: 1
1: 7
2: 34
3: 97
4: 875
1117422634_1117422640 -7 Left 1117422634 14:55562085-55562107 CCCTCACCTTCTTCATATTGAGT 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG 0: 1
1: 7
2: 34
3: 97
4: 875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117422640 Original CRISPR ATTGAGTAGGCTAAGGAGGA AGG Intronic
900912167 1:5606201-5606223 ATTGATTATGCTGAGGAGGAGGG + Intergenic
901697130 1:11016384-11016406 ACTCAGGAGGCTGAGGAGGAAGG - Intronic
902351350 1:15857767-15857789 ACTGAGAAGGCTAAGGTGGGAGG - Intronic
902568214 1:17329581-17329603 GTTGAGTAGGCTGAGGAGGAAGG + Intronic
902717299 1:18281627-18281649 AAGGAGTGGGCTGAGGAGGAAGG - Intronic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903011543 1:20334382-20334404 ATTGAGTAAGCAAAGGAGAATGG - Intronic
903059467 1:20659799-20659821 ATTCAGGAGGCTGAGGAGGGAGG + Intronic
903076650 1:20774258-20774280 ATTTAGGAGGCTGAGGAGGGAGG + Intronic
903205161 1:21776478-21776500 ATTTAGGAGGCTGAGGAGGGAGG + Intronic
903762081 1:25705832-25705854 ATTCAAGAGGCTAAGGTGGAAGG + Intronic
904004077 1:27354367-27354389 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
904065111 1:27743654-27743676 ATTCAGTAGGCTGAGGTGGGAGG + Intronic
905140597 1:35840856-35840878 CTTTAGAAGGCCAAGGAGGAAGG - Intronic
906137693 1:43511153-43511175 ACTCAGGAGGCTAAGGCGGAAGG + Intergenic
906170064 1:43717604-43717626 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
906896710 1:49781283-49781305 ATTCAGGAGGCTGAGGCGGAAGG + Intronic
907020652 1:51063814-51063836 ATTGGGTATGCTAAAGAGGTGGG - Intergenic
907172213 1:52479006-52479028 GTTGAGTACGCTAAAAAGGATGG + Intronic
907228154 1:52969053-52969075 GTTGAGTAGGCTGAGGAGGAAGG + Intronic
907476955 1:54712270-54712292 ATTGATTAGGGTAAGGAGGAGGG + Intronic
907607505 1:55832945-55832967 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
907733877 1:57092960-57092982 ATTGAGAAGGCGATGGAAGAGGG + Intronic
908155553 1:61349085-61349107 ATGAAATAGGCTATGGAGGAAGG - Intronic
908281476 1:62541481-62541503 ATTGAATAGGCTGAAGAGGAGGG - Intronic
908338451 1:63151406-63151428 CTTTAGTGGGCTAATGAGGAAGG - Intergenic
908397028 1:63735098-63735120 AATCAGGAGGCTAAGGTGGAAGG - Intergenic
909715773 1:78704377-78704399 ATTAAGTAGGATATGGAGGCAGG + Intergenic
910090992 1:83464087-83464109 ACTGAGTAGGCTAAGGAGGTGGG + Intergenic
910551273 1:88478070-88478092 ATTCAGTTGGCTGAGGAGGGAGG - Intergenic
911008115 1:93248862-93248884 ATTAAGGAGGCTGAGGTGGAAGG + Intronic
912170552 1:107094159-107094181 GTTGAGTAGGCTGAGGGGAAGGG - Intergenic
912330429 1:108815405-108815427 ACTCAGTAGGCTAAGGCGGGAGG + Intergenic
912539293 1:110400532-110400554 ATTGAGTAGGCTGAAAAGGAGGG - Intergenic
914733451 1:150393347-150393369 ATTTAGGAGGCTGAGGTGGATGG + Intronic
914813998 1:151049659-151049681 ATTCAGCAGGCTAAGGTGGGAGG - Intronic
914817409 1:151073121-151073143 ATTCAGGAGGCTAAGGCGGGAGG - Intronic
914883602 1:151567025-151567047 ATTGGGTAGGCTGAGGTGGGAGG - Intronic
914901984 1:151716019-151716041 ATTGAGGCGGCCCAGGAGGAGGG + Exonic
915652957 1:157332632-157332654 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
915786187 1:158614998-158615020 GATGAGTAGGCTCAGGTGGATGG + Intronic
916226313 1:162493204-162493226 CTTTGGGAGGCTAAGGAGGAAGG + Intergenic
916331135 1:163618508-163618530 CTTAAGTAGGCAAGGGAGGAAGG + Intergenic
917044159 1:170838273-170838295 ATTGGGTAGGATAAGCAGGGAGG - Intergenic
917823050 1:178786111-178786133 ATCGAGTAGACTGAGGAAGAAGG + Intronic
918060065 1:181053271-181053293 ACTGAGGAGGCTAAGGTGGGAGG + Intronic
918074918 1:181162712-181162734 ATTAAGTAGGCTGAGGAGGTGGG + Intergenic
918228309 1:182507809-182507831 CTTGAGGAGGCTGAGGTGGAAGG - Intronic
918558219 1:185830777-185830799 ACTGAGGAGGCTGAGGTGGAAGG + Intronic
919029505 1:192222538-192222560 CTTAAGTAAGCTAAGGAGGATGG - Intergenic
919170974 1:193953690-193953712 ATTTGGGAGGCTAAGGTGGAAGG - Intergenic
919721397 1:200840505-200840527 CTTGAGGAGGCTGAGGAGGAAGG - Intronic
920188974 1:204180202-204180224 AATTAGGAGGCTGAGGAGGAAGG + Intergenic
920288863 1:204902184-204902206 ATTCAGTAGGCTGAGGTGGGAGG + Intronic
920291608 1:204927629-204927651 TTTGGGAAGGCTAAGGAGGAGGG - Intronic
920293929 1:204944353-204944375 ACTGAGGAGGCAGAGGAGGAAGG - Exonic
920413490 1:205781370-205781392 GTTGAATAGACCAAGGAGGAGGG + Intergenic
920571143 1:207018878-207018900 TATGTGTAGGCTAAGAAGGAAGG - Exonic
921233472 1:213098222-213098244 ATTCAGGAGGCTGAGGAGGGAGG - Intronic
921510824 1:216026875-216026897 ATTGAGTACGATAATGAGGCAGG - Intronic
921600719 1:217103547-217103569 CTTGAGGAGGCTGAGGAGGGAGG + Intronic
921866256 1:220090607-220090629 ACTTGGGAGGCTAAGGAGGAAGG - Intergenic
921966754 1:221098598-221098620 ATAGAGGAAGTTAAGGAGGAAGG + Intergenic
921974749 1:221190212-221190234 ATTTGGGAGGCTAAGGAGGGAGG + Intergenic
921979458 1:221240010-221240032 ATTAAGTAAGCAGAGGAGGATGG + Intergenic
922928028 1:229366807-229366829 ATTCAGGAGGCTGAGGAGGATGG + Intergenic
922940676 1:229462664-229462686 ATTCAGGAGGCTAAGGTGGCAGG - Intronic
924606793 1:245542242-245542264 ACTCAGGAGGCTAAGGAGGGAGG + Intronic
924729427 1:246698042-246698064 ATTGTGTGAGCCAAGGAGGATGG + Intergenic
924744598 1:246819813-246819835 CTTTAGGAGGCCAAGGAGGAGGG + Intergenic
924750018 1:246878286-246878308 ATTCAGTAGGCTAAGGTGGGAGG + Intronic
1062878068 10:957903-957925 ACTGAGGAGGCTGAGGAGGGAGG - Intergenic
1063412501 10:5847457-5847479 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
1063685849 10:8236574-8236596 ATTGTGGAGGCTAAGGTGGAAGG - Intergenic
1063935150 10:11070181-11070203 GTTTAGCAGGCAAAGGAGGAGGG + Intronic
1064536789 10:16365676-16365698 ACTGTGGAGGCTAAGGAGGGAGG - Intergenic
1064763021 10:18641472-18641494 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1065205151 10:23350054-23350076 ACTGAGGAGGCTAAGGTGGGAGG + Intergenic
1065276377 10:24090273-24090295 ACTTAGGAGGCTAAGGAGGAAGG - Intronic
1065381260 10:25093228-25093250 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
1065591394 10:27265767-27265789 ATTCAGGAGGCCAAGGTGGAAGG - Intergenic
1065707576 10:28484885-28484907 GTTGAGTAGGCTAGGGAGGATGG + Intergenic
1065722015 10:28636286-28636308 CTTTAGGAGGCTAAGGAGGGTGG + Intergenic
1065741505 10:28801295-28801317 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
1065762174 10:28992578-28992600 ATTTGGGAGGCTGAGGAGGAAGG - Intergenic
1065776200 10:29122499-29122521 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
1065793043 10:29279082-29279104 GTTGAGTAAGCTGAGGAGGAGGG - Intergenic
1065874891 10:29989020-29989042 AATCAGGAGGCTAAGGTGGAAGG - Intergenic
1065912388 10:30320153-30320175 ATTGAGGAGGCTGAGGTGGGAGG + Intronic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1066640832 10:37552574-37552596 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
1067305400 10:45059682-45059704 ATTCAGGAGGCTAAGGTGGGAGG - Intergenic
1067383243 10:45794649-45794671 ATTCAGGAGGCTAAGGTGGGAGG - Intergenic
1067766066 10:49088413-49088435 ATTGAGCAGGTCAAGGAGGTTGG - Intronic
1067880921 10:50044113-50044135 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1067890949 10:50135197-50135219 ATTCAGGAGGCTAAGGTGGGAGG - Intergenic
1068507123 10:57915173-57915195 ATTAAGTAGACTGAGGAGGAGGG + Intergenic
1068727288 10:60317460-60317482 ATCAAGCAGGCTAAGGAGGATGG - Intronic
1069003467 10:63292057-63292079 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1069674459 10:70237724-70237746 CTTTAGGAGGCTGAGGAGGACGG + Intergenic
1069681327 10:70287676-70287698 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
1070026987 10:72641185-72641207 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
1070225877 10:74505027-74505049 ACTGAGCAGGCTGAAGAGGAGGG + Intronic
1071103977 10:82072873-82072895 ACTCAGAAGGCTGAGGAGGAAGG - Intronic
1071235661 10:83645288-83645310 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
1071578259 10:86746245-86746267 ATTCAGGAGGCTAAGGAGGGAGG - Intergenic
1072204148 10:93187657-93187679 ACTGAAGAGGCTAAGGAGGGAGG + Intergenic
1072511215 10:96127885-96127907 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1072610799 10:97016647-97016669 ATTTGGGAGGCTAAGGTGGAAGG - Intronic
1072942433 10:99778529-99778551 ATTCAGGAGGCTGAGGTGGAGGG - Intergenic
1072991818 10:100202870-100202892 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1073130092 10:101182729-101182751 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1073417851 10:103399451-103399473 ACTCAGGAGGCTAAGGAGGGAGG - Intronic
1073934242 10:108611685-108611707 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1074321329 10:112405936-112405958 CTTGAGTGGGTTGAGGAGGAGGG + Intronic
1074425428 10:113347296-113347318 AGTCAGTAGGCTAAAGTGGATGG + Intergenic
1074754944 10:116617457-116617479 ACTCAGGAGGCTAAGGAGGCAGG - Intergenic
1075104950 10:119532929-119532951 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
1075106941 10:119545690-119545712 ACTTAGGAGGCTAAGGAGGGAGG - Intergenic
1075364754 10:121875761-121875783 ATTCACTAAGGTAAGGAGGAAGG - Intronic
1075388722 10:122076869-122076891 CTTTAGGAGGCTAAGGCGGACGG + Intronic
1076285349 10:129290204-129290226 AATGAGGACCCTAAGGAGGATGG + Intergenic
1076752807 10:132552152-132552174 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076752819 10:132552209-132552231 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076752831 10:132552266-132552288 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076752843 10:132552323-132552345 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076752856 10:132552380-132552402 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076752867 10:132552437-132552459 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076752879 10:132552494-132552516 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076752890 10:132552551-132552573 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076752912 10:132552665-132552687 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076752925 10:132552722-132552744 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076752940 10:132552779-132552801 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076752951 10:132552836-132552858 ATTGAGTAGGACAGGGAGGGAGG + Intronic
1076752964 10:132552893-132552915 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076752977 10:132552950-132552972 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076752990 10:132553009-132553031 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076753001 10:132553066-132553088 ATTGAGTAGGACAGGGAGGGAGG + Intronic
1076753014 10:132553123-132553145 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076753027 10:132553180-132553202 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076753040 10:132553237-132553259 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076753053 10:132553294-132553316 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076753065 10:132553351-132553373 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076753076 10:132553408-132553430 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076753087 10:132553465-132553487 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076753099 10:132553524-132553546 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076753110 10:132553583-132553605 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076753121 10:132553642-132553664 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076753133 10:132553701-132553723 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1076753144 10:132553760-132553782 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076753157 10:132553817-132553839 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076753170 10:132553874-132553896 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076753183 10:132553931-132553953 ATTGGGTAGGATAGGGAGGGAGG + Intronic
1076753204 10:132554045-132554067 ATTGAGTAGGACAGGGAGGGAGG + Intronic
1076753216 10:132554102-132554124 ATTGAGTGGGATAGGGAGGGAGG + Intronic
1077206114 11:1345335-1345357 ATTGAGTGGGCTGAGGAGCAAGG - Intergenic
1077999257 11:7480210-7480232 AATCAATAGGCAAAGGAGGAGGG - Intergenic
1078164074 11:8867689-8867711 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1078335272 11:10458201-10458223 ATTTGGGAGGCTGAGGAGGAAGG - Intronic
1078637099 11:13062405-13062427 CTTCAGGAGGCCAAGGAGGATGG - Intergenic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079233893 11:18673641-18673663 AGTGAGTAGGCTGAGGAGGTAGG - Intergenic
1079426697 11:20350093-20350115 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
1080535026 11:33213037-33213059 CTTTAGGAGGCTAAGGAGGGCGG + Intergenic
1080866846 11:36203043-36203065 ACTCAGGAGGCTAAGGAGGGAGG - Intronic
1081371934 11:42314760-42314782 GTTGAGTACGATGAGGAGGAGGG + Intergenic
1081574862 11:44312609-44312631 CTTTAGGAGGCCAAGGAGGATGG + Intergenic
1081881973 11:46461132-46461154 ATTTAGGAGGCTGAGGTGGAAGG + Intronic
1081882053 11:46461983-46462005 ATTGACTAGGGCAGGGAGGAAGG - Intronic
1081882133 11:46462668-46462690 ATTGACTAGGGCAGGGAGGAGGG - Intronic
1082051364 11:47773032-47773054 CTTTGGTAGGCTAAGGTGGACGG - Intergenic
1082218636 11:49605060-49605082 TTTGAGGAGCCTAAGGAGGCAGG + Intergenic
1082704579 11:56478118-56478140 CTTTAGGAGGCTAAGGTGGAAGG - Intergenic
1083557176 11:63639644-63639666 ACTGAGGAGGCTAAGGTGGGAGG + Intronic
1084471734 11:69365668-69365690 GTTGAGTGGGCTGAGGAGGAGGG + Intronic
1084628704 11:70330826-70330848 ACTCAGGAGGCTAAGGAGGGAGG + Intronic
1084631422 11:70354040-70354062 ATGGAGGAGGCTGAGGATGAGGG + Intronic
1085051984 11:73384673-73384695 AGTGAGCAGGCTGAGGGGGAAGG - Intronic
1085210941 11:74777735-74777757 ACTCAGGAGGCTAAGGCGGAAGG - Intronic
1085585763 11:77704184-77704206 ACTGGGTAGGCTGAGGTGGAAGG + Intronic
1085752889 11:79177606-79177628 GTAGAGTGGGATAAGGAGGAAGG + Intronic
1085837766 11:79974711-79974733 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1086131534 11:83407079-83407101 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG + Intronic
1086344406 11:85881529-85881551 ATTCAGGAGGCTGAGGAGGGAGG - Intronic
1086393366 11:86389044-86389066 ATTTTGGAGGCTAAGGAGGGAGG + Intronic
1086630932 11:89019058-89019080 TTTGAGGAGCCTAAGGAGGCAGG - Intronic
1086647324 11:89240085-89240107 ATTGAGTAGGGTGGGGTGGAGGG + Intronic
1086935444 11:92741148-92741170 ACTGGGGAGGCTAAGGTGGAAGG - Intronic
1087126382 11:94630356-94630378 GCTGAGTAGGCTGAGAAGGAAGG + Intergenic
1087440585 11:98178465-98178487 ATTTAGGAGGCTAAGAAGGGAGG - Intergenic
1088214869 11:107496739-107496761 ATTTGGGAGGCTGAGGAGGAAGG - Intergenic
1088297910 11:108321024-108321046 GTTGAGTAGGATAAGGAGGAAGG + Intronic
1088331574 11:108659593-108659615 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
1088531917 11:110819651-110819673 TTTGGGTAGGGGAAGGAGGAGGG + Intergenic
1089279139 11:117360477-117360499 ACTCAGGAGGCTGAGGAGGATGG - Intronic
1089421609 11:118336063-118336085 TTTTAGGAGGCTGAGGAGGAAGG + Intergenic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089948815 11:122506580-122506602 ATTGAGGAGGCTGAGGTGGGAGG - Intergenic
1090046400 11:123338501-123338523 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
1090143232 11:124289004-124289026 ATTCAGAAGGCTAAGGTGGAAGG - Intergenic
1091833561 12:3568249-3568271 ATGGAATAGGCTGAGGAGGAGGG + Intronic
1092164483 12:6334604-6334626 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1092535462 12:9382379-9382401 ATTCAGGAGGCTAAGGTGGGAGG - Intergenic
1093201797 12:16196523-16196545 TTTGAATAGGCTTAGAAGGATGG - Intronic
1093241794 12:16685973-16685995 ATTGAGGAAGGGAAGGAGGAGGG - Intergenic
1093587151 12:20852368-20852390 ATTGAGGAGGCTGAGGTGGGAGG + Intronic
1093601412 12:21028919-21028941 ATTGAGTAGGTGGAGGAGGGAGG - Intronic
1093718954 12:22415447-22415469 ACTCAGGAGGCTAAGGAGGAAGG + Intronic
1093819113 12:23590248-23590270 ATTAATTAGGCTAGGGAGGTAGG + Intronic
1094097855 12:26728064-26728086 ATGTTCTAGGCTAAGGAGGATGG + Intronic
1094122906 12:26993012-26993034 ATTGAGGAGGCTGAGGTGGGAGG - Intronic
1094454132 12:30613694-30613716 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
1094539691 12:31352713-31352735 ACTCAGGAGGCTAAGGAGGGAGG + Intergenic
1095094300 12:38137518-38137540 ATTTAGGAGGCTGAGGAGGGCGG - Intergenic
1095636356 12:44438498-44438520 ATTAAGAGGGCCAAGGAGGATGG - Intergenic
1096104684 12:48990104-48990126 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096710337 12:53451133-53451155 ATTTAGGAGGCTGAGGTGGATGG - Intergenic
1096999249 12:55862583-55862605 ATTCAGGAGGCTGAGGAGGGAGG + Intergenic
1097063971 12:56306632-56306654 ACTCAGTAGGCTAAGGTGGGAGG - Intronic
1097169185 12:57103102-57103124 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1097425279 12:59436762-59436784 ATTCAGGAGGCTAAGGAAGGGGG + Intergenic
1097646040 12:62235823-62235845 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
1097676429 12:62607040-62607062 ATTGAATGAGCTAAGGGGGAAGG + Intergenic
1098335538 12:69400938-69400960 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
1098405354 12:70120166-70120188 ATAGAGTAGGTTAAAGAGAATGG + Intergenic
1099194586 12:79600588-79600610 ACTTGGTAGGCTAAGGTGGAAGG - Intronic
1100951930 12:99860397-99860419 ATTTAGTAGTTTAGGGAGGAAGG + Intronic
1100969588 12:100053294-100053316 ATTCAGGAGGCTGAGGAGGCAGG + Intronic
1100993397 12:100275308-100275330 ACTCAGTAGGCTGAGGTGGAAGG - Intronic
1101615387 12:106331379-106331401 AGTGAGTAGGCTAAGCAGTGGGG - Intronic
1102129589 12:110516116-110516138 ACTTGGTAGGCTAAGGTGGAAGG + Intronic
1102133084 12:110548864-110548886 TTTGAGGAGGCAAAAGAGGAGGG - Intronic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1103094186 12:118119551-118119573 ATTCAGGAGGCTAAGGTGGGAGG + Intronic
1103137121 12:118517166-118517188 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1103227709 12:119302560-119302582 ATTGATTACGCTAATGATGATGG + Intergenic
1103259662 12:119575571-119575593 GTTGTGTAGGCTAGGGAGGTCGG - Intergenic
1103507426 12:121451170-121451192 ATTGTGTAGGCAGAGGAGGAGGG - Intronic
1103514083 12:121495541-121495563 TTTTGGTAGGCTAAGGAGGGAGG - Intronic
1103806928 12:123580958-123580980 GTTGAGTAGGCTGAAGAGGAGGG - Intergenic
1103840523 12:123859919-123859941 ACTCAGGAGGCTAAGGAGGGAGG + Intronic
1104703872 12:130928080-130928102 ACTGGGGAGGCTAAGGTGGAAGG + Intergenic
1105555568 13:21444945-21444967 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
1106354614 13:28969148-28969170 ATTTGGGAGGCTAAGGTGGAAGG - Intronic
1106446684 13:29839543-29839565 ACTTGGGAGGCTAAGGAGGAAGG + Intronic
1106803621 13:33282919-33282941 ACTGAGGAGGCTGAGGTGGAAGG + Intronic
1106996882 13:35494899-35494921 ACTGAGGAGGCTTAGGTGGAAGG + Intronic
1106997023 13:35496523-35496545 ATTCAGTAGGCTAAGGTGGAAGG + Intronic
1107668722 13:42720190-42720212 ATTGAGGAGGCTATGGAAGGGGG - Intergenic
1107705560 13:43100314-43100336 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
1107855886 13:44615113-44615135 ACTCAGTAGGCTAAGGTGGGAGG + Intergenic
1107873584 13:44769149-44769171 ATTGGGGAGGCTAAGGTGGGAGG + Intergenic
1108187959 13:47907345-47907367 ATTCAGGAGGCTGAGGAGGGAGG + Intergenic
1110080479 13:71303825-71303847 ATTGATTTGGCAAAGGAGGCAGG - Intergenic
1110275521 13:73638062-73638084 ACTCAGAAGGCTGAGGAGGAAGG + Intergenic
1110316094 13:74108803-74108825 ACTGAGTAGGCTAAGGAGGAGGG + Intronic
1110357982 13:74590560-74590582 ATTCAGGAGGCTAAGGCAGAAGG - Intergenic
1111173418 13:84560558-84560580 ACTTAGAAGGCTAAGGTGGAGGG + Intergenic
1111174257 13:84572519-84572541 ATTGAATAGGCAAGAGAGGATGG + Intergenic
1112380610 13:98885494-98885516 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
1112557215 13:100479634-100479656 GTTGAGTTGGCTGAGGAGGAGGG + Intronic
1112595385 13:100802950-100802972 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
1112939351 13:104842308-104842330 ACTTAGGAGGCTAAGGTGGAAGG - Intergenic
1113189214 13:107724668-107724690 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1115215398 14:31008928-31008950 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
1115382353 14:32755634-32755656 ACTCAGGAGGCTAAGGTGGAGGG - Intronic
1115582864 14:34778961-34778983 ACTCAGTAGGCTAAGGTGGGAGG - Intronic
1115663586 14:35522682-35522704 ACTGGGGAGGCTAAGGTGGAAGG + Intergenic
1115876623 14:37868674-37868696 ACTGATGAGGCTAGGGAGGAGGG + Intronic
1116009731 14:39336997-39337019 ATTCAGGAGGCTGAGGAGGGAGG - Intronic
1116194211 14:41701741-41701763 GTTGAGAAGGCTCAGGATGATGG + Intronic
1117165974 14:53034018-53034040 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1117282537 14:54255059-54255081 GTTGAGTAGGCTGAGAAGGAGGG + Intergenic
1117384700 14:55199718-55199740 ATTGAGTAGGCTGAAGAGGAGGG + Intergenic
1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG + Intronic
1118231117 14:63950763-63950785 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
1118333469 14:64832396-64832418 ACAGAGCAGGCAAAGGAGGAAGG - Intronic
1118582357 14:67314997-67315019 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
1119031103 14:71193332-71193354 ATTGTGTAGGCTGAAGAGGGGGG - Intergenic
1119042133 14:71284488-71284510 ATTGAGTAGTATTAGGAGAAGGG + Intergenic
1119200790 14:72751080-72751102 ACTGAGGAGGCCAAGGTGGAAGG + Intronic
1119336458 14:73837489-73837511 ATTTGGGAGGCCAAGGAGGATGG - Intergenic
1119354034 14:73990441-73990463 ACTCGGGAGGCTAAGGAGGAAGG - Intronic
1119673537 14:76537325-76537347 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
1119681414 14:76594915-76594937 ACTGAGTAGGCTCAGGATGAAGG + Intergenic
1119953426 14:78769758-78769780 ATTGATTATGCTGAGGAGGTAGG + Intronic
1120055709 14:79921540-79921562 ACTGAGTGGGTGAAGGAGGAAGG + Intergenic
1120425258 14:84339471-84339493 ATTGACTAGGCTGAGGAGCAGGG - Intergenic
1121071507 14:91026472-91026494 ATTTGGGAGGCTAAAGAGGAAGG - Intronic
1121347390 14:93146170-93146192 ATTGAGAAGGCTAAGGGGCCAGG + Intergenic
1121856255 14:97272854-97272876 ACTCGGGAGGCTAAGGAGGAAGG - Intergenic
1121929336 14:97958148-97958170 ACTTGGCAGGCTAAGGAGGAAGG - Intronic
1123101404 14:105804198-105804220 ACTCAGTAGGCTAAGGCAGAAGG - Intergenic
1124615015 15:31235318-31235340 ATTTAGGAGGCTAAGGTGGGAGG - Intergenic
1125361713 15:38871536-38871558 ACTGGGGAGGCTAAGGTGGAAGG - Intergenic
1125389691 15:39178750-39178772 GTTGGGTAGGCACAGGAGGATGG + Intergenic
1125660366 15:41389662-41389684 ATTCAGGAGGCTAAGGTGGGAGG + Intronic
1125981296 15:44003751-44003773 ATAGAGTAGGGTAAGGAAAATGG - Intronic
1126748729 15:51853698-51853720 ACTCAGGAGGCTGAGGAGGAGGG + Intronic
1127505436 15:59593470-59593492 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
1127535304 15:59884694-59884716 GTTGAGTAGGCTGAGGAGGAGGG - Intergenic
1127587076 15:60388676-60388698 CTTTGGTAGGCTAAGGCGGAGGG - Intronic
1128001731 15:64199140-64199162 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
1128443832 15:67739169-67739191 ATTCAGGAGGCTGAGGAGGGAGG + Intronic
1128632241 15:69279146-69279168 ATTGAGGAGGCTGAGAATGAGGG - Intergenic
1128954838 15:71928960-71928982 ACTGAGGAGGCTGAGGTGGAAGG + Intronic
1129052416 15:72793600-72793622 ATTCAGAAGGCTGAGGAGGGAGG - Intergenic
1129139447 15:73584020-73584042 ATAGAGAAAGCTAAGGAGTAGGG + Intronic
1129415278 15:75373478-75373500 GTTGAGTAGGCTGAAGAGGGAGG - Intronic
1129421275 15:75428881-75428903 ATTGAGGAGGCTGAGGAGGAGGG - Intronic
1129849802 15:78786906-78786928 GTTGAGTAGGCTGAGGAGGGAGG - Intronic
1130252462 15:82308799-82308821 GTTGAGTACGCTGAGGAGGGAGG + Intergenic
1130406898 15:83610422-83610444 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
1130924535 15:88375212-88375234 ATTGTGTTGGCAAAGGTGGAAGG + Intergenic
1131161049 15:90105049-90105071 ACTGAGGAGGCTAAGGTGGGAGG - Intergenic
1131227931 15:90640571-90640593 ATTTGGGAGGCTAAGGTGGACGG + Intronic
1131333805 15:91527362-91527384 ATTCAGTAGGCTAAGGTGGGAGG + Intergenic
1133211483 16:4265499-4265521 ACTGAGGAGGCTAAGGTGGGAGG + Intronic
1133472976 16:6093728-6093750 ATTTAGGAGGCTGAGGAGAAAGG - Intronic
1134075878 16:11290918-11290940 ATGGAGAAGGCTTGGGAGGAGGG + Intronic
1134103176 16:11467194-11467216 CTTGGGGAGGCCAAGGAGGATGG - Intronic
1134420435 16:14082669-14082691 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
1134478468 16:14596632-14596654 GCTCAGGAGGCTAAGGAGGAGGG + Intronic
1134621943 16:15696096-15696118 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
1134747312 16:16598274-16598296 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
1134998159 16:18755384-18755406 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
1135033547 16:19058014-19058036 ACTCAGGAGGCTAAGGAGGGAGG - Intronic
1135429031 16:22366601-22366623 ATTAAGGAGGCTGAGGAGGGTGG + Intronic
1135434063 16:22413410-22413432 CTTTGGGAGGCTAAGGAGGAAGG - Intronic
1135469512 16:22717008-22717030 ATTAAGGAGGTTGAGGAGGAAGG + Intergenic
1135634118 16:24059556-24059578 ACTGGGGAGGCTAAGGTGGAAGG + Intronic
1135685731 16:24497071-24497093 ATTCAGTAGGGTCTGGAGGAAGG + Intergenic
1135694936 16:24577398-24577420 ATGAAGCAGGCAAAGGAGGAAGG - Intergenic
1135968744 16:27056677-27056699 CTTGAGTAGGGTAAGGAGTCAGG - Intergenic
1136351950 16:29716198-29716220 CTTTAGGAGGCTAAGGAGGGTGG + Intergenic
1136374974 16:29860050-29860072 ACTTAGGAGGCTAAGGTGGAAGG - Intronic
1136447184 16:30329618-30329640 CTTTAGGAGGCCAAGGAGGAAGG + Intergenic
1136724317 16:32345815-32345837 ATTCAGAAGGCTGAGGAAGAAGG + Intergenic
1136842644 16:33551856-33551878 ATTCAGAAGGCTGAGGAAGAAGG + Intergenic
1136948718 16:34688961-34688983 ATTTGGTAGGCCAAGGTGGAAGG - Intergenic
1137392087 16:48090334-48090356 ACTGAGAAGGTTAAGGAGGTAGG - Intronic
1137451026 16:48573941-48573963 TTTGAATAAGCTGAGGAGGAGGG + Intronic
1137458306 16:48635148-48635170 ATTCAGGAGGCTGAGGAGGAAGG + Intergenic
1138174353 16:54883194-54883216 ATTCAGGAGGCCAAGGAGGGAGG + Intergenic
1138323893 16:56144758-56144780 GTTGGGGAGGCGAAGGAGGAAGG + Intergenic
1139291055 16:65858287-65858309 ACTGAGGAGGCTAAGGCGGGAGG - Intergenic
1139748969 16:69097041-69097063 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
1139845182 16:69915928-69915950 ATTCAGGAGGCTAAGGTGGGAGG + Intronic
1140072754 16:71666402-71666424 ACTTAGTAGGCTGAGGAGGAAGG + Intronic
1140175127 16:72651048-72651070 CTTGAGGAGGCTGAGGAGGGTGG - Intergenic
1140203855 16:72917130-72917152 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
1140215235 16:73001709-73001731 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1140861729 16:79024365-79024387 ACTGAGGAGGCTAAGGTGGGAGG - Intronic
1141121770 16:81364372-81364394 ATTCAGTAGGCTGAGGTGGGAGG - Intronic
1141184141 16:81774987-81775009 ATTTGGGAGGCTAAGGAGGGTGG - Intronic
1141439449 16:84020250-84020272 ACTCAGGAGGCTGAGGAGGAGGG - Intronic
1141646994 16:85372865-85372887 GATGAGAAGGCTAAGGAGGAGGG + Intergenic
1141822560 16:86457105-86457127 ATTTGGGAGGCTAAGGCGGATGG - Intergenic
1142336388 16:89491855-89491877 ACTTAGTAGGCTAAGGTGGGAGG - Intronic
1203002113 16_KI270728v1_random:171950-171972 ATTCAGAAGGCTGAGGAAGAAGG - Intergenic
1203133716 16_KI270728v1_random:1708357-1708379 ATTCAGAAGGCTGAGGAAGAAGG - Intergenic
1203152809 16_KI270728v1_random:1852153-1852175 ATTCAGAAGGCTGAGGAAGAAGG + Intergenic
1142489391 17:268263-268285 GTTGGGTAGGCTGAGGAGGAAGG - Intronic
1143220775 17:5259838-5259860 ATTCAGTAGGCTGAGGTGGAAGG + Intergenic
1143459265 17:7090393-7090415 ATTGAGAAGGCTAAGGTGGGAGG + Intergenic
1143547760 17:7608998-7609020 ATTTAGGAGGCTAAGGTGGGAGG + Intronic
1143718385 17:8792641-8792663 ATGGAGCACGCTACGGAGGAGGG + Intergenic
1144398513 17:14870462-14870484 GTAGAGTAGGCTAAGGAGGAGGG + Intergenic
1144594703 17:16558866-16558888 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
1144941043 17:18941198-18941220 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1145068007 17:19776642-19776664 TTTGAGTAGCCACAGGAGGATGG - Intronic
1145283188 17:21483301-21483323 GTTGAGGAGGCTGGGGAGGAGGG - Intergenic
1145394294 17:22482499-22482521 GTTGAGGAGGCTGGGGAGGAGGG + Intergenic
1146217828 17:30992572-30992594 ACTCAGGAGGCTAAGGAGGGAGG - Intronic
1146313691 17:31790758-31790780 ATTCAGGAGGCTGAGGAGGGAGG - Intergenic
1146384100 17:32354082-32354104 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
1147397071 17:40152244-40152266 ATTGAGGAGGCTGAGGTGGGAGG - Intronic
1147684456 17:42278460-42278482 ACTGAGGAGGCTAAGGTGGGAGG + Intergenic
1147846694 17:43409309-43409331 ACTCAGAAGGCTAAGGAGGGAGG + Intergenic
1148003168 17:44402538-44402560 ATTCAGAAGGCTGAGGAGGGAGG + Intronic
1148253331 17:46105760-46105782 ACTCAGTAGGCTGAGGAGGGAGG + Intronic
1148655950 17:49283698-49283720 CTTTAGGAGGCTCAGGAGGAAGG - Intergenic
1148703441 17:49606397-49606419 CTTGGGGAGGCCAAGGAGGAAGG - Intronic
1148932168 17:51135937-51135959 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
1149028474 17:52057323-52057345 GTTGAGTAGGCTGAGGAGGAGGG - Intronic
1149230160 17:54523957-54523979 AGTGAGTAGGCGAAGGAGTTTGG - Intergenic
1149441415 17:56677787-56677809 ATTGATCAGGTTGAGGAGGAGGG - Intergenic
1149599269 17:57882676-57882698 ATTGAGTAGGCTGAGGAGGAGGG - Intronic
1149629893 17:58114063-58114085 ATTGAGTAGAATATGCAGGAAGG - Intergenic
1149634242 17:58153927-58153949 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1150031791 17:61745475-61745497 ACTCAGGAGGCTAAGGTGGAGGG - Intronic
1150122835 17:62617932-62617954 ATTCAGAAGGCTGAGGTGGAAGG - Intergenic
1150652839 17:67021090-67021112 ATTCAGGAGGCTAAGGTGGGCGG + Intronic
1150781895 17:68130368-68130390 CTTGAGTAGGCAAAGGAGGCAGG + Intergenic
1150907560 17:69354638-69354660 ACTCAGTAGGCTGAGGTGGAAGG - Intergenic
1151239540 17:72746936-72746958 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
1151641451 17:75398412-75398434 AATGAGTAGGCTATGGTGGCTGG - Intronic
1151846924 17:76663054-76663076 ATTCAGGAGGCTGAGGGGGAAGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152317817 17:79591076-79591098 AGTGAGCAGGCTTGGGAGGAAGG - Intergenic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152411690 17:80127530-80127552 ACTAAGGAGGCTAAGGTGGAAGG + Intergenic
1152676420 17:81643672-81643694 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
1152833657 17:82515316-82515338 CTTGAGGAGGCTGAGGCGGATGG + Intergenic
1153222520 18:2874296-2874318 ACTCAGGAGGCTAAGGAGGAAGG - Intronic
1153920279 18:9782803-9782825 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1153982712 18:10324958-10324980 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1155106592 18:22672837-22672859 ATTGAGTAGACTGAGGAGGAGGG - Intergenic
1155193225 18:23449670-23449692 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1155511047 18:26577652-26577674 ATTCAGCAGGCTGAGGAGGGAGG - Intronic
1155808667 18:30205296-30205318 ATTCAGTAGGCTGAGGTGGGAGG + Intergenic
1155904201 18:31429608-31429630 AGTGAAAAGGCAAAGGAGGAAGG + Intergenic
1156101176 18:33596922-33596944 ACTTAGGAGGCTAAGGTGGAAGG - Intronic
1156821215 18:41375491-41375513 CTTTAGGAGGCTAAGGAGGGAGG + Intergenic
1157009055 18:43624318-43624340 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
1157210052 18:45734629-45734651 ATTCAGAAGGCTGAGGGGGAAGG + Intronic
1157336426 18:46741856-46741878 CTTTGGGAGGCTAAGGAGGATGG + Intronic
1157660349 18:49436119-49436141 ACTCAGAAGGCTAAGGCGGAAGG - Intronic
1158129439 18:54136501-54136523 ATTGGGTAAGCTGAGGAGGAGGG - Intergenic
1158248058 18:55453969-55453991 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1158755026 18:60313005-60313027 ATTGAGTAGGATGAGTGGGAGGG - Intergenic
1159043013 18:63343185-63343207 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
1159931235 18:74315148-74315170 ATTAAGTAGGGTAGGGAGGCGGG - Intergenic
1160212220 18:76890894-76890916 GTTGAGTAGGCTGAGGAAGTCGG - Intronic
1160744168 19:702997-703019 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
1160992731 19:1866665-1866687 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
1161248001 19:3265227-3265249 ATTGAGGAGGCTGAGGTGGGAGG + Intronic
1161334117 19:3702882-3702904 ACTTAGTAGGCTAAGGTGGGAGG + Intergenic
1161415750 19:4145502-4145524 AGGGAGGAGGCTGAGGAGGAGGG + Intergenic
1161466787 19:4435480-4435502 ACTGAGGAGGCTAAGGTGGGAGG - Intronic
1161623843 19:5314026-5314048 ACTCAGTGGGCTAAGGTGGAAGG + Intronic
1161868420 19:6852120-6852142 ATTCAGGAGGCTGAGGAGGGAGG - Intronic
1162119649 19:8455590-8455612 ATTGAGTAGGGTGAGAAGGTTGG + Intronic
1162558826 19:11403988-11404010 ATTCAGGAGGCTGAGGAGGGAGG - Intronic
1162562986 19:11428348-11428370 ACTGAGGACGCTGAGGAGGAAGG - Intronic
1162598715 19:11650127-11650149 ATTGAGTAGCCTGAAGAGGAGGG + Intergenic
1163351628 19:16779877-16779899 ACTTGGTAGGCTAAGGAGGGAGG - Intronic
1163562572 19:18028895-18028917 ATTCAGTAGGCTGAGGTGGGAGG + Intergenic
1163778999 19:19235852-19235874 ACTGGGGAGGCTAAGGAGGGAGG - Intronic
1164162058 19:22633723-22633745 CTTTAGGAAGCTAAGGAGGATGG + Intergenic
1164413334 19:28023504-28023526 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
1164433215 19:28206555-28206577 CTTCAGTAGGCCAAGGTGGAAGG + Intergenic
1164592311 19:29513550-29513572 GATGAGGAGGATAAGGAGGAAGG + Intergenic
1164592326 19:29513599-29513621 GATGAGGAGGATAAGGAGGAAGG + Intergenic
1164921808 19:32093907-32093929 AGTGAGTGGGATAAGAAGGAAGG + Intergenic
1165357115 19:35311086-35311108 CTTTAGGAGGCCAAGGAGGAAGG + Intronic
1165491312 19:36124784-36124806 CTTTAGTAGGCTGAGGAGGGTGG - Intronic
1165700996 19:37937631-37937653 ACTTAGGAGGCTTAGGAGGAAGG + Intronic
1165789849 19:38484721-38484743 CTTCAGGAGGCTGAGGAGGAGGG + Intronic
1165798483 19:38532986-38533008 ATTGAGGAGGCTCAGGCAGAGGG + Intronic
1165877756 19:39021394-39021416 AATGAGTAGGCTGAAGAGGAGGG - Intronic
1166010419 19:39936956-39936978 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1166034168 19:40155307-40155329 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
1166442210 19:42824702-42824724 ACTCAGGAGGCTAAGGAGGGAGG + Intronic
1166461633 19:42992990-42993012 ACTCAGGAGGCTAAGGAGGGAGG + Intronic
1166478928 19:43152961-43152983 ACTCAGGAGGCTAAGGAGGGAGG + Intronic
1166501598 19:43345305-43345327 ACTCAGGAGGCTAAGGAGGAAGG + Intergenic
1166508515 19:43388151-43388173 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
1166691153 19:44821761-44821783 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1167153961 19:47726783-47726805 TTGGGGCAGGCTAAGGAGGAAGG - Intronic
1167342788 19:48925801-48925823 CTTCAGGAGGCCAAGGAGGAAGG + Intergenic
1167373112 19:49096298-49096320 ATTTGGGAGGCTAAGGCGGACGG - Intronic
1168378081 19:55897409-55897431 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
925045529 2:770620-770642 GTTGAGCAGGCTGAGGAGGAGGG + Intergenic
925047173 2:781368-781390 ATTCAGGGGGCTAAGGTGGAAGG + Intergenic
926258501 2:11233103-11233125 ACTCAGGAGGCTAAGGAGGGAGG + Intronic
926392888 2:12412259-12412281 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
926748986 2:16183455-16183477 ATTCAGGAGGCTCAGAAGGAAGG + Intergenic
927267987 2:21174453-21174475 ACTGAGAAGACTAAGGAGGGAGG - Intergenic
927289161 2:21388087-21388109 AGTGAGTAGACTAAGGAATAGGG + Intergenic
927669021 2:25053349-25053371 AGAGAGTAGGCTGAGGAGGGCGG + Intronic
927793822 2:26031662-26031684 ATTCAGGAGGCTGAGGAGGGAGG - Intergenic
928350696 2:30551085-30551107 ATTAAGGAGGCTGAGGCGGAAGG - Intronic
928715128 2:34051242-34051264 GTTGGGTAGGCTGAGGAGGAGGG - Intergenic
928903812 2:36350278-36350300 ATTCAGGAGGCTAAGGTGGCAGG - Intergenic
929061436 2:37928708-37928730 CTTGAGAAGGCAAAGGAGGTGGG - Intronic
929088963 2:38195864-38195886 ATTCAGTATTCTAAGGAGGGAGG - Intergenic
930717781 2:54609004-54609026 GTTGAGTAGGCTGAGGAGGAAGG + Intronic
931050911 2:58413451-58413473 ACTGAGGAGGCTGAGGTGGAAGG + Intergenic
931343219 2:61422889-61422911 ACTGAGGAGGCTGAGGTGGAAGG + Intronic
931709278 2:64974239-64974261 ACTCAGTAGGCTGAGGAGGTGGG - Intergenic
932151229 2:69373509-69373531 ACTGAGGAGGCTACGGAGGGAGG + Intronic
932156507 2:69422956-69422978 GTTGAGGAGGCTGAGGAGGTGGG - Intronic
932179360 2:69631869-69631891 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
932490997 2:72120284-72120306 ATTCAGGAGGCTCAGGAGGAAGG + Intergenic
932558701 2:72848480-72848502 ATAGAGCAAGGTAAGGAGGATGG + Intergenic
932858290 2:75262217-75262239 ATAAAGTAGGGTAAGGAGAATGG + Intergenic
933307265 2:80617766-80617788 ATTTAGTACGCTAAGAATGATGG + Intronic
933684029 2:85129049-85129071 AATGTATAGGCTAAGGAGTATGG + Intergenic
933849143 2:86351721-86351743 ATTCAGTAGGCTGAGGTGGGAGG - Intergenic
934027283 2:88011831-88011853 ACTGAGGAGGCTAAGGTGGAAGG - Intergenic
934127251 2:88907893-88907915 ATTGAGTAGGCTGAGGAGGAGGG - Intergenic
934232102 2:90193326-90193348 ATTTGGGAGGCCAAGGAGGATGG - Intergenic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
935726767 2:106030538-106030560 AGTGAGTAAGGCAAGGAGGAAGG + Intergenic
936541383 2:113354932-113354954 GTTGGTGAGGCTAAGGAGGATGG - Intergenic
936831238 2:116650440-116650462 GCTGAGCAGGCCAAGGAGGAAGG + Intergenic
936931318 2:117792129-117792151 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
937104534 2:119297613-119297635 ACTGAGGAGGCTGAGGAGGGAGG - Intergenic
937176846 2:119945745-119945767 GTTGACTAGGCTTTGGAGGATGG + Intronic
937405337 2:121622458-121622480 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
937550156 2:123077971-123077993 ATTGAGTAGGCAAAGGAGAAGGG + Intergenic
937569629 2:123340490-123340512 ATAATGTAGGCTGAGGAGGAGGG - Intergenic
937775745 2:125773701-125773723 ACTGGGTCGGGTAAGGAGGAGGG + Intergenic
937964815 2:127496678-127496700 ATTCAGGAGGCTAAGGTGGAAGG - Intronic
938530991 2:132185895-132185917 CTTTAGGAGGCTGAGGAGGACGG + Intronic
938819498 2:134941257-134941279 ACAGAGTAGGCTGAGGAAGAGGG - Intronic
939200535 2:139028770-139028792 ATTGAATAGGCTGAGGGGGAGGG - Intergenic
939968586 2:148635473-148635495 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
941064857 2:160890303-160890325 ATTCAGGAGGCTGAGGAGGGAGG + Intergenic
941342363 2:164323159-164323181 TTTTAGAAGGCTGAGGAGGAAGG - Intergenic
941463544 2:165799193-165799215 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
941959457 2:171239349-171239371 ATTTAGGAAGCTAAGGTGGAAGG - Intergenic
942016620 2:171823844-171823866 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
942205976 2:173620410-173620432 ATTTAGGAGGCTGAGGAGGGTGG - Intergenic
942267536 2:174243318-174243340 ATTCAGGAGGCTGAGGAGTAGGG + Intronic
942478967 2:176361854-176361876 GTTGAGTAGGCTGAGGAGGAAGG + Intergenic
942527520 2:176870462-176870484 ATTGAGGAGGCCCAGGTGGAAGG - Intergenic
943584882 2:189726388-189726410 ATGCAGTAGGCTAAGGTGGGAGG - Intronic
943776495 2:191772399-191772421 CTTGCTTATGCTAAGGAGGAGGG + Intergenic
944068518 2:195644694-195644716 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
944647218 2:201792013-201792035 TTTGGGTAGGCTGAGGTGGAAGG - Intronic
944945002 2:204673692-204673714 ATACAGTAGGATGAGGAGGATGG - Intronic
945555806 2:211274298-211274320 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
946346634 2:219116463-219116485 ACTGAGGAGGCTGAGGTGGAAGG - Intronic
946367113 2:219255170-219255192 ACTGAGGAGGCTGAGGTGGAAGG - Intronic
947246144 2:228050913-228050935 ACTGAGGAGGCTAAGGTGGGAGG - Intronic
947309735 2:228788113-228788135 ATTGAGTAGGCTGTGGAGGAGGG - Intergenic
947354172 2:229275043-229275065 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
947762608 2:232614383-232614405 CTTGAGGAGGCAGAGGAGGAAGG - Intronic
947885849 2:233570326-233570348 ATTGAGTGGGCTGTTGAGGAGGG - Intergenic
948093520 2:235315291-235315313 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
948112504 2:235467758-235467780 ACTCAGTAGGCTAAGGAGGAAGG + Intergenic
949069840 2:242017834-242017856 ACTGGGGAGGCTGAGGAGGAAGG + Intergenic
1168755304 20:312645-312667 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
1168915990 20:1488537-1488559 ATTTGGTAGGCTAAGGTGGGAGG + Intronic
1169600979 20:7260524-7260546 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
1169706145 20:8507203-8507225 GTTGAGTAGGCCATGGAGGAGGG + Intronic
1170227690 20:14010330-14010352 ATTGAATAGGCTTAGGAGGATGG + Intronic
1171956489 20:31467859-31467881 ATTTAGGAGGCTGAGGTGGAAGG - Intronic
1172121971 20:32603830-32603852 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1172294784 20:33801213-33801235 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
1172706512 20:36886234-36886256 ACTGGGGAGGCTAAGGTGGAAGG - Intronic
1172921006 20:38482248-38482270 GTTGAGTAGGCTGAGGAGTAAGG + Intronic
1172991932 20:39042989-39043011 AATGAGCAGGCTAGGGAGGCTGG + Intergenic
1173496480 20:43522579-43522601 ACTCAGAAGGCTAAGGAGGGAGG - Intronic
1173605116 20:44326370-44326392 ATTGAGGAGGCTGAGGCAGAAGG + Intergenic
1173696421 20:45018834-45018856 ATTCAGGAGGCTAAGGCAGAAGG - Intronic
1173896633 20:46555930-46555952 ACTCAGTAGGCTAAGGTGGGAGG + Intergenic
1173974660 20:47178217-47178239 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
1174795000 20:53514686-53514708 ATTCAGGAGGCTGAGGTGGAGGG - Intergenic
1175053518 20:56177045-56177067 ATTGAATAGGATGAGGAGCAAGG - Intergenic
1175854951 20:62115796-62115818 ATTCAGCAGGCTGAGGTGGAAGG - Intergenic
1176765470 21:13013523-13013545 CTTTAGGAGGCTGAGGAGGATGG - Intergenic
1177021963 21:15873217-15873239 ACTCAGGAGGCTGAGGAGGAAGG - Intronic
1177259162 21:18706778-18706800 GTTGAGTAGGCTGAGGAGAGGGG - Intergenic
1177613322 21:23483174-23483196 GTTGAGAAGGCTTAGGAGGAGGG + Intergenic
1177906639 21:26979447-26979469 ATTCTGTAGGCTAAGGTGGGAGG - Intergenic
1178101446 21:29272739-29272761 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
1178448718 21:32671196-32671218 ATTCAGAAGGCTGAGGAGGGAGG + Intronic
1178591892 21:33917905-33917927 ACTGGGGAGGCTAAGGTGGAAGG - Intergenic
1178842530 21:36149233-36149255 ACTTGGTAGGCTAAGGTGGAAGG + Intergenic
1178868840 21:36354176-36354198 GTTGAGTAGGCTGAGGAAGAAGG + Intronic
1179009813 21:37547510-37547532 AATGACTCGGCTAAAGAGGAAGG - Intergenic
1179185031 21:39079087-39079109 ACTCAGGAGGCTAAGGAGGGAGG + Intergenic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1179520005 21:41936700-41936722 GTTGAGTAGGCTGAGGAGGAGGG - Intronic
1180512659 22:16108323-16108345 CTTTAGGAGGCTGAGGAGGATGG - Intergenic
1180616958 22:17134673-17134695 ATTAAGTAGGGTAAGGATGATGG + Intergenic
1180645870 22:17338303-17338325 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
1180657704 22:17437200-17437222 ATTTAGGAGGCCAAGGGGGAAGG - Intronic
1181368300 22:22397044-22397066 ACTGAGGAGGGTGAGGAGGAGGG - Intergenic
1181378016 22:22475954-22475976 TTTTAGGAGGCTGAGGAGGAAGG - Intergenic
1181470343 22:23135060-23135082 ACTCAGTAGGCTAAGGTGGGAGG + Intronic
1181472515 22:23149644-23149666 ACTGAGGAGGCTGAGGTGGAAGG - Intronic
1182706721 22:32286716-32286738 ATTAAGAAGGCTAAGAAAGAAGG + Intergenic
1183152187 22:36046604-36046626 ACTCAGGAGGCTAAGGAGGGAGG + Intergenic
1183378650 22:37479648-37479670 ATTGTGTAAGCTCATGAGGAGGG + Intronic
1183572839 22:38667117-38667139 ATTCAGTAGGCTTAGGTGGGAGG - Intronic
1183731765 22:39622364-39622386 ATTGAGTAGGTGGAGGGGGAGGG + Intronic
1184395028 22:44229792-44229814 ATTAAGAAGGCTAAGAAAGAAGG + Intergenic
1184633731 22:45807880-45807902 ATTGAGGAGACTGAGGAGGGGGG + Intronic
1184673838 22:46029519-46029541 ACTGAGGAGGCTGAGGAGGGAGG + Intergenic
949523824 3:4883148-4883170 ACTCAGTAGGCTGAGGTGGAAGG + Intronic
949647205 3:6109630-6109652 ATTCGGTAGGCTGAGGAGGGAGG - Intergenic
949697712 3:6718590-6718612 ATTGAGTAGGCTGAGACTGAAGG + Intergenic
949736800 3:7181852-7181874 ATTCAGGAGGCCAAGGAGGGAGG - Intronic
950066859 3:10118893-10118915 GCTGAGTAGGCTGAGGAAGAAGG - Intronic
950327366 3:12123900-12123922 ACTCAGTAGGCTAAGGTGGGAGG + Intronic
950431015 3:12951177-12951199 CTTTAGGAGGCCAAGGAGGATGG + Intronic
950802602 3:15566545-15566567 ACTCAGAAGGCTAAGGAGGCAGG + Intronic
951195053 3:19814367-19814389 ACTGGGGAGGCTAAGGAGGGAGG + Intergenic
951204803 3:19914981-19915003 GTTCAGGAGGCTAAGGTGGAAGG + Intronic
951218409 3:20045121-20045143 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
951680799 3:25292636-25292658 ATTAAGAAAGCTAAAGAGGAAGG - Intronic
951980335 3:28559109-28559131 ATTGAATAGGGAAAGGAGAAGGG - Intergenic
951987702 3:28639253-28639275 ATTGAGTAGGCTGAGGAGGAGGG + Intergenic
952112481 3:30140004-30140026 CTTGACTAGGCTGAGGAGAAGGG + Intergenic
952353950 3:32567645-32567667 ACTCAGGAGGCTAAGGTGGAGGG - Intronic
952441111 3:33330172-33330194 ACTGAGGAGGCTGAGGTGGAAGG + Intronic
952643686 3:35629663-35629685 ACTCAGTAGGCTGAGGTGGAAGG + Intergenic
952712856 3:36449008-36449030 ATTCAGGAGGCTAAGGCAGAAGG + Intronic
953396247 3:42572971-42572993 ATTCAGAATGCTAAGGTGGAAGG - Intronic
953608834 3:44430428-44430450 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
953860766 3:46542386-46542408 ACAGAGAAGGCTAAGGTGGAAGG + Intronic
954009810 3:47626043-47626065 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
954247753 3:49345082-49345104 ATTAAGTAGGCCAAGGTGGGAGG + Intergenic
954270879 3:49507772-49507794 ACTCAGGAGGCTAAGGAAGAAGG - Intronic
954670558 3:52289168-52289190 ACTGAGCAGGGTAAGGAGGCTGG - Intronic
954944154 3:54403244-54403266 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955855872 3:63272826-63272848 AATGAGTATGCCAAGGAAGAAGG - Intronic
956075138 3:65496989-65497011 ATTGAGAAGGCTGAGGGGAAAGG + Intronic
956103114 3:65789070-65789092 ACTGAGGAGGCTAAGGCGGGAGG + Intronic
956120305 3:65959541-65959563 ACTTAGTAGGCTAAGGTGGGAGG - Intronic
956699168 3:71943742-71943764 GTTGAGTAGGTTGAGGAGGAGGG + Intergenic
956796801 3:72725113-72725135 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
956923776 3:73959870-73959892 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
957191911 3:77020959-77020981 CTTTGGTAGGCTAAGGTGGAAGG + Intronic
957400679 3:79708756-79708778 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
958196527 3:90247971-90247993 ATTGAGGAGGGTAAACAGGAAGG + Intergenic
958419717 3:93916608-93916630 ATTGAGGAGGGTAAACAGGAAGG + Intronic
958468938 3:94494203-94494225 ATTGAGTTGGCTGAGGAGAAAGG + Intergenic
958654031 3:96978260-96978282 GTTGAGTAGGCTGAAGAGAAGGG + Intronic
958797778 3:98724298-98724320 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
959597004 3:108139711-108139733 GTTGAGTAGGCGGAAGAGGAGGG - Intergenic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
960893392 3:122475912-122475934 GTTGAGTAAGCTGAGGAGGAGGG + Intronic
961032172 3:123615755-123615777 ATGCAGTAGGCTGAGGTGGAAGG - Intronic
961221071 3:125200338-125200360 ATTTAGGAGGCTGAGGAGGGAGG + Intronic
961494339 3:127280235-127280257 ACTGAGGAGGCTGAGGTGGAAGG + Intergenic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
961864504 3:129943876-129943898 ATTCAGGAGGCTAAGGCGGGAGG - Intergenic
961872234 3:129996856-129996878 AGCAAGGAGGCTAAGGAGGATGG - Intergenic
962562364 3:136619952-136619974 ATTCAGGAGGCTGAGGAGGTGGG + Intronic
962783520 3:138744467-138744489 ACTGAGTAGGCTGAGGAGGAGGG + Intronic
963022923 3:140889435-140889457 ACTTGGGAGGCTAAGGAGGAAGG + Intergenic
963157006 3:142109984-142110006 ACTGAGTAGGCTGAGGTGGGAGG - Intronic
963249720 3:143091985-143092007 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
963496402 3:146068101-146068123 GCTGAGTAGGCTGAGAAGGAAGG - Intergenic
963815366 3:149825065-149825087 ACTGAGAAGGCTAAGGCAGAAGG - Intronic
964020443 3:152004073-152004095 ACTCAGGAGGCTAAGGCGGATGG + Intergenic
964218264 3:154313569-154313591 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
964331405 3:155607548-155607570 ACTCAGAAGGCTAAGGTGGAAGG - Intronic
964360222 3:155888153-155888175 ATTTTTTAGGCTAAGGAGGGGGG - Intronic
964529797 3:157655224-157655246 ATTGTGTTGGTTAAGGAGGGTGG - Intronic
965543642 3:169893962-169893984 TGAGAATAGGCTAAGGAGGAGGG + Intergenic
965553102 3:169990208-169990230 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
965595942 3:170411367-170411389 ACTGAGGAGGCTAAGGCAGAAGG - Intergenic
966344705 3:178965683-178965705 ATTCAGGAGGCTAAGGAGGGAGG + Intergenic
966645601 3:182243603-182243625 ATTCAGTAGGCTGAGGTAGAAGG - Intergenic
966699624 3:182833432-182833454 ATTTGGTAGGCTGAGGTGGAAGG - Intronic
966949974 3:184807546-184807568 CTTTGGTAGGCCAAGGAGGATGG - Intergenic
967038583 3:185667365-185667387 ATTGAGGAGGCTGAGGTGGGAGG + Intronic
967065742 3:185913703-185913725 GTTGAGTAGGCTGAGGGGGTGGG + Intergenic
967475587 3:189913313-189913335 ACTCAGTAGGCTAAGGCGGGAGG - Intergenic
968023536 3:195417838-195417860 ATTGAGGAGGCTAAGGTGGGAGG + Intronic
968202692 3:196769081-196769103 ATTTGGGAGGCCAAGGAGGATGG + Intronic
968248456 3:197180347-197180369 ACTGTGTATGCTAAGTAGGACGG + Intronic
968477105 4:816711-816733 ATTCAGGAGGCTAAGGTAGAAGG + Intronic
968952019 4:3700249-3700271 AGTGGGGAGGGTAAGGAGGAGGG + Intergenic
970314800 4:14819068-14819090 ATTAGGGAGGCTAAGGTGGAAGG - Intergenic
970594258 4:17585529-17585551 ATTGAGGAGGCTAGGGTGGGAGG - Intronic
970694596 4:18662569-18662591 ATTAAGTAGGCAAAGAATGAAGG - Intergenic
970780947 4:19736756-19736778 ACTCAGGAGGCTAAGGAGGGAGG + Intergenic
970971593 4:21990452-21990474 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
971120000 4:23692970-23692992 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
971376148 4:26057268-26057290 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
971633461 4:29026111-29026133 ATTCAGGAGGCTGAGGAGGAAGG + Intergenic
972864057 4:43208611-43208633 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
973765334 4:54157016-54157038 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
973865855 4:55112256-55112278 GTTGAGTAGGCTGAGGAAAAGGG - Intronic
973929990 4:55782379-55782401 GTTGAGTAGGCTGAGGAGGAGGG - Intergenic
973963993 4:56141800-56141822 ATTTGGGAGGCTAAGGAGGGAGG - Intergenic
974558112 4:63478613-63478635 CTTTAGGAGGCCAAGGAGGATGG + Intergenic
976231351 4:82846565-82846587 ATTGAATATGCTGAAGAGGAGGG - Intronic
976278071 4:83298717-83298739 ACTCAGAAGGCTGAGGAGGAAGG + Intronic
976391181 4:84505582-84505604 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
977531684 4:98207889-98207911 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
977686610 4:99853708-99853730 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
978512960 4:109541463-109541485 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
979065095 4:116121575-116121597 ACTGAGTAGTCACAGGAGGATGG + Intergenic
979125920 4:116971235-116971257 ATTCAGAAGGCTGAGGAGAAGGG + Intergenic
980120955 4:128727206-128727228 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
980551278 4:134338877-134338899 GTTTAGGAGGCTGAGGAGGATGG + Intergenic
980986423 4:139699793-139699815 ATTTGGGAGGCTAAGGTGGAGGG + Intronic
981406451 4:144375286-144375308 ATGGTGGAGGTTAAGGAGGAGGG - Intergenic
981956046 4:150475651-150475673 CTTTAGAAGGCTAAGGAGGGAGG + Intronic
982605659 4:157514030-157514052 ACTCAGAAGGCTAAGGAGGGAGG - Intergenic
982664594 4:158245817-158245839 ACTCAGAAGGCTAAGGAGGGAGG + Intronic
982815793 4:159882773-159882795 ATTGAGTAGGCCGAAAAGGAGGG + Intergenic
983617642 4:169725576-169725598 CTCGAGTAGGCAAGGGAGGATGG + Intergenic
983647899 4:170010518-170010540 GTTGAGTAGACTGAGGAGGAGGG - Intronic
983692424 4:170487077-170487099 GTTGAGTAGGCTGAGGAGGAGGG + Intergenic
983741909 4:171145381-171145403 TTTGAGTAGGCTAAGAAAGAGGG - Intergenic
984475658 4:180231143-180231165 ATTCAGAAGGCAAAGGAGAAGGG + Intergenic
986099945 5:4598896-4598918 ATGGAGTCGGCTAAGGAGGGAGG - Intergenic
987027424 5:13941247-13941269 ACTGAGGAGGCTGAGGTGGAAGG + Intronic
987131963 5:14868783-14868805 ATTGCTTAGGCTAAGGTGGGAGG - Intronic
987746024 5:21973096-21973118 ATTAAGGAGGCTCAGGTGGAGGG + Intronic
988462042 5:31448336-31448358 ATTGGGCAGGCTAAGGAACATGG + Intronic
988539197 5:32094071-32094093 ACTGAGTAGCCTGAGAAGGAGGG + Intronic
988780548 5:34517297-34517319 ATTCAGGAGGCTGAGAAGGAAGG - Intergenic
989395025 5:40945753-40945775 ACTTAGGAGGCTAAGGTGGAAGG + Intronic
989698132 5:44228402-44228424 ACTGAGTAGGCTAAGGATAAGGG + Intergenic
990248445 5:53888387-53888409 ACTGAGGAGGCTAAGGTGGGAGG - Intronic
990440040 5:55835125-55835147 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
990574883 5:57114766-57114788 ATTCAGGAGGCTAAGGTGGGAGG - Intergenic
990595194 5:57305965-57305987 ACTGTGGAGGCTAAGGTGGAAGG - Intergenic
991118336 5:62980759-62980781 AGTGGGGAGGCTAAGGAGGGAGG - Intergenic
991621862 5:68552890-68552912 ATTGAATAGGCTGAGGAGGAGGG + Intergenic
991766232 5:69983207-69983229 ATTAAGGAGGCTCAGGTGGAGGG + Intergenic
991781087 5:70134946-70134968 ATTAAGGAGGCTCAGGTGGAGGG - Intergenic
991845466 5:70858290-70858312 ATTAAGGAGGCTCAGGTGGAGGG + Intergenic
991873532 5:71135260-71135282 ATTAAGGAGGCTCAGGTGGAGGG - Intergenic
991917945 5:71623927-71623949 TTTGAGTAGGGGAAGAAGGATGG - Intronic
991971317 5:72144500-72144522 ACTTTGTAGGCTAAGGAGGGAGG - Intronic
992465012 5:76995442-76995464 ATTGTGGAGGCTGAGGAGGCAGG - Intergenic
992472445 5:77071599-77071621 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
992706537 5:79400598-79400620 CTTTGGGAGGCTAAGGAGGATGG - Intronic
992799266 5:80281161-80281183 ACTGAGGAGGCTAAGGTGGGAGG - Intergenic
992884025 5:81139934-81139956 ACTCAGGAGGCTTAGGAGGAAGG - Intronic
993708430 5:91197292-91197314 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
994448260 5:99905875-99905897 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
994681222 5:102889740-102889762 AATAAGGGGGCTAAGGAGGAGGG - Intronic
995069168 5:107898385-107898407 ATTGAGTAGGCTTACAAGGAGGG - Intronic
995284713 5:110374648-110374670 AGTTAGTTGGCTAAGGATGATGG + Intronic
995351683 5:111183479-111183501 ATTGAGGAGGCTGAGGTGGGAGG - Intergenic
995517550 5:112969171-112969193 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995896300 5:117015169-117015191 ATTGAATAGACTAATGAGGAAGG - Intergenic
995914939 5:117233656-117233678 ATTGAGTACGTTATGGAGCATGG + Intergenic
996564777 5:124868319-124868341 ATGGGGGAGGCTAAGGAGGGAGG - Intergenic
996723205 5:126649780-126649802 CTTTAGGAGGCTGAGGAGGACGG + Intergenic
996799565 5:127388255-127388277 ACTCAGGAGGCTGAGGAGGAAGG - Intronic
997519567 5:134514080-134514102 ATTTAGGAGGCTGAGGTGGATGG - Intergenic
997643427 5:135464778-135464800 ACTGAGAAGGCTGAGGTGGAAGG - Intergenic
998860350 5:146437407-146437429 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
999775035 5:154805399-154805421 ATTGAGCAGGCTGAGAAGGAGGG + Intronic
999893942 5:156008482-156008504 ACTCAATAGGCTAAGGAGGCAGG - Intronic
1000055433 5:157602172-157602194 GTTTAGGAGGCTGAGGAGGAAGG - Intergenic
1000700087 5:164438562-164438584 GTTAAGTAGGCTGAGGAAGAGGG + Intergenic
1001507999 5:172295696-172295718 ATTCAGTAGGCTGAGGCAGAAGG - Intergenic
1001719145 5:173842117-173842139 ATTTGGGAGGCTGAGGAGGAAGG + Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002119092 5:176987713-176987735 ACTTGGCAGGCTAAGGAGGAGGG + Intronic
1002147672 5:177198132-177198154 ACTGAGGAGGCTGAGGTGGAAGG - Intronic
1002162750 5:177325688-177325710 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
1002411167 5:179077912-179077934 ACTGAGGAGGCTAAGGTGAAAGG - Intronic
1002555089 5:180030976-180030998 ATTGAGTAGGCTTAGGGGGTAGG - Intronic
1003207806 6:4029450-4029472 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1003294829 6:4816605-4816627 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1003447176 6:6195276-6195298 GTTGAGTTGCCAAAGGAGGAAGG - Intronic
1003592717 6:7449191-7449213 ACTTAGGAGGCTAAGGTGGAAGG - Intergenic
1003839496 6:10105363-10105385 ATTCAGGAGGCTGAGGTGGAAGG + Intronic
1003865840 6:10361780-10361802 ACTGAGGAGGCTAAGGAAGAAGG - Intergenic
1003979207 6:11374140-11374162 ATTGAGTGAGCAAAGGAGTAAGG - Intronic
1004454842 6:15782874-15782896 ATTGAGTAGGCTGAGGAGGAGGG + Intergenic
1004482633 6:16035460-16035482 ACTCAGAAGGCTAAGGTGGAAGG + Intergenic
1004686867 6:17954780-17954802 ACTCAGGAGGCTAAGGAGGGAGG - Intronic
1004894979 6:20139660-20139682 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1005592834 6:27347222-27347244 CTTTAGTAGGCTGAGGAGGGCGG + Intergenic
1006178046 6:32135175-32135197 ATTCAGGAGGCTAAGGCGGAAGG + Intergenic
1006496476 6:34426959-34426981 ATTGAGGAGGCTGAGGCGGGAGG + Intergenic
1006522151 6:34577109-34577131 ATTTGGGAGGCTGAGGAGGAAGG - Intergenic
1006563602 6:34935193-34935215 ACTGAGGAGGCTAAGGTGGGAGG - Intronic
1006605734 6:35256103-35256125 ATTGTGTAGGCAAAGAAGTATGG + Intergenic
1006684592 6:35821981-35822003 ATTCAGGAAGCTAAGGTGGAAGG - Intronic
1007065621 6:38987724-38987746 ATTCAGTAGGATAAGGAAGTGGG - Intronic
1007153609 6:39719872-39719894 ATTCAGGAGGCTAAGGTGGGAGG + Intronic
1007553881 6:42750267-42750289 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
1007567314 6:42862091-42862113 CTTGAGGAGGCCAAGGCGGATGG + Intronic
1007897913 6:45381534-45381556 ACTGAGGAGGCTGAGGTGGAAGG - Intronic
1007940385 6:45775198-45775220 ATTGGGTAGGCTAAGCAGCTTGG - Intergenic
1008532819 6:52480284-52480306 GTTGAGTAGGCTGAGAAGGATGG + Intronic
1008672856 6:53791412-53791434 ACTCAGAAGGCTAAGGTGGAAGG - Intergenic
1009498664 6:64383042-64383064 ATTTGGGAGGCTAAGGTGGATGG + Intronic
1010780407 6:79939630-79939652 ATTGAGAAGGCTGAGGGAGAAGG - Intronic
1011271960 6:85588914-85588936 ACTGGGTAGGCTGAAGAGGAGGG + Intronic
1011408891 6:87045004-87045026 ACTGAGTAGGATAGGGAGGTGGG + Intergenic
1011738068 6:90332517-90332539 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
1011865899 6:91826561-91826583 GTTGAGTAGAGGAAGGAGGAAGG - Intergenic
1011916851 6:92516750-92516772 ATTTGGTAGGCTAAGGTGGGAGG + Intergenic
1012252763 6:96997165-96997187 ATTGAGCAAGCAAATGAGGAAGG + Intronic
1012283726 6:97362879-97362901 ATTCAGGAGGCTGAGGAGGGAGG - Intergenic
1012409265 6:98937549-98937571 GTTGAGTAGGCTGAGAAGGGAGG + Intronic
1012425054 6:99104907-99104929 GTTTAGGAGGCTAAGGTGGAAGG - Intergenic
1012901105 6:105007631-105007653 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1013140766 6:107332211-107332233 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013901155 6:115157142-115157164 GTTGAGTAGGCTGAGGAGGAGGG - Intergenic
1014230496 6:118896944-118896966 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1014297189 6:119633722-119633744 GTTGAGTAGCCTGAGGAAGAGGG - Intergenic
1014652890 6:124062949-124062971 ATTTGGTAGGCCAAGGAGGGTGG + Intronic
1014775892 6:125509520-125509542 GTTGAGTAGTATTAGGAGGATGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015370032 6:132440129-132440151 ATTGAGTAGGGTGAGAGGGATGG - Intergenic
1015750774 6:136556255-136556277 CTTTAGGAGGCTAAGGAGGACGG + Intergenic
1015751178 6:136560836-136560858 ATTCAGGAGGCTAAGGTGGGAGG + Intronic
1016304914 6:142673689-142673711 ATTGAGTAGGGGAGGCAGGAGGG + Intergenic
1016348677 6:143143801-143143823 ATTGAGTTACCTAAGAAGGAAGG + Intronic
1016376425 6:143425407-143425429 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
1016380506 6:143473761-143473783 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
1016464090 6:144308715-144308737 TTTGAGTAAGTAAAGGAGGATGG - Intronic
1016940533 6:149479779-149479801 ACTTAGTAGGCTAAGGTGGGAGG - Intronic
1017335279 6:153251039-153251061 ATTGAATAGGCCAGAGAGGATGG - Intergenic
1017417173 6:154233626-154233648 ATTGATTACGCTAATGAGGATGG + Intronic
1017917694 6:158845260-158845282 CTTGGGGAGGCTAAGGAGGGAGG - Intergenic
1017933773 6:158985537-158985559 ACTCAGTAGGCTAAGGCAGAAGG - Intronic
1017996158 6:159533316-159533338 ATTAAGTAGGCAGAGGAGAATGG - Intergenic
1019380191 7:717547-717569 ATTCAGGAGGCTAAGGTGGCAGG + Intronic
1019968386 7:4520094-4520116 AGTGAGGAGGCTAAGGGAGAAGG + Intergenic
1019980961 7:4621773-4621795 ATTGAGTAGGCTGAGCATGGTGG + Intergenic
1020155486 7:5720266-5720288 GTTGAGTAGGCTGAGGAGGAGGG - Intronic
1020658585 7:10955652-10955674 ACTGAGGAGGCTGAGGTGGAAGG + Intergenic
1021919686 7:25472359-25472381 ATTGAGCTGGTTAAGGTGGAAGG - Intergenic
1022577498 7:31512098-31512120 TTAGAGAAGGCTAAGGAAGATGG + Intergenic
1023085403 7:36565639-36565661 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
1023114619 7:36850163-36850185 ATTGAGTAGGCTGAAGAGGAGGG - Intergenic
1023115708 7:36859956-36859978 ATTGAGTAGGATGAGGGAGAAGG - Intronic
1023376196 7:39558164-39558186 ACTGAGAAGGGTAGGGAGGAGGG + Intergenic
1023376393 7:39560098-39560120 ACTCAGGAGGCTAAGGAGGGAGG + Intergenic
1023536935 7:41223316-41223338 CTTGGGGAGGCTAAGGAGGGTGG + Intergenic
1024115649 7:46190566-46190588 CTTTAGAAGGCTAAGGAGGGTGG - Intergenic
1025085345 7:56019032-56019054 ATTAAGGAGGCTAAGGAGGGAGG + Intronic
1026059911 7:67016734-67016756 ACTCAGTAGGCTAAGGTGGGAGG - Intronic
1026277175 7:68890214-68890236 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
1026483215 7:70796583-70796605 AGTCAGGAGGCTGAGGAGGAGGG - Intergenic
1026586831 7:71662254-71662276 TTTGGGGAGGCTCAGGAGGATGG - Intronic
1026675309 7:72423706-72423728 ACTTGGGAGGCTAAGGAGGAAGG + Intronic
1026718193 7:72808339-72808361 ACTCAGTAGGCTAAGGTGGGAGG + Intronic
1026886010 7:73945950-73945972 ACTGAGGAGGCTAAGGTGGGAGG + Intergenic
1026949437 7:74337702-74337724 AGTGAGGAGGCTAAGGTGGGAGG - Intronic
1027191998 7:76002049-76002071 ACTCAGAAGGCTAAGGCGGAGGG - Intronic
1027307832 7:76920579-76920601 ACCGAGTAGGCTGAGGAGGTGGG + Intergenic
1027441315 7:78221939-78221961 ATTTAGGAGGCTAAGGTGGGAGG + Intronic
1028136373 7:87227316-87227338 ATTCAGTAGGCTGAGGTGGGAGG + Intergenic
1028844595 7:95465606-95465628 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
1028909686 7:96194189-96194211 CTTGAGGAGGCTGAGGTGGATGG + Intronic
1029143386 7:98428327-98428349 ATTCAGGAGGCTGAGGAGGGAGG - Intergenic
1029342157 7:99954064-99954086 ACCGAGTAGGCTAAGGAGGAAGG - Intergenic
1029464095 7:100714730-100714752 CTTTAGGAGGCTAAGGAGGGAGG - Intergenic
1029712209 7:102306004-102306026 ATTTGGGAGGCTAAGGTGGAAGG - Intronic
1029716459 7:102329899-102329921 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1029854000 7:103494926-103494948 ATGGAGTAAGATAAAGAGGAAGG + Intronic
1030002714 7:105082574-105082596 GTTGAGTAGGCTGAGGAGGAAGG + Intronic
1030036857 7:105415430-105415452 ATTCAGGAGGCTGAGGAGGGAGG - Intergenic
1030131296 7:106203699-106203721 TTTGAGTAGGTTGGGGAGGAAGG + Intergenic
1030207481 7:106964989-106965011 ATTAAGTAGGGGAAGGAAGAAGG - Intergenic
1030221102 7:107099741-107099763 ACTCAGGAGGCTAAGGAGAATGG - Intronic
1030222266 7:107109504-107109526 ATTTAGGAGGCTGAGGTGGAAGG - Intronic
1030418580 7:109277616-109277638 GCTGAGTAGGCTGAGGAGGTGGG - Intergenic
1031039761 7:116827089-116827111 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1031365143 7:120891872-120891894 ATTGAGTAGGGTGAGAAGGAAGG + Intergenic
1031425772 7:121603815-121603837 ATAAAGAAGGCTAAGGGGGATGG - Intergenic
1031468852 7:122145501-122145523 ACTTAGGAGGCTAAGGTGGAAGG + Intergenic
1032022170 7:128413802-128413824 GTTGAGTAGGCAAAGGCAGATGG - Intergenic
1032149819 7:129418664-129418686 ATTGAGGAGGCTGAGGTGGGAGG + Intronic
1032176370 7:129631326-129631348 ATTCAGGAGGCTCAGGTGGAAGG - Intronic
1032204197 7:129847402-129847424 ACTCAGGAGGCTAAGGAGGGAGG + Intronic
1032235540 7:130118966-130118988 ATTTAGGAGGCCAAGGAGGGAGG + Intronic
1032548155 7:132760899-132760921 AAAGAGTAGGCAGAGGAGGATGG + Intergenic
1033080368 7:138290946-138290968 CTTTGGGAGGCTAAGGAGGATGG - Intergenic
1033394404 7:140959893-140959915 ACTGAGGAGGCTAAGGCGGGAGG + Intergenic
1033680777 7:143594456-143594478 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
1033704115 7:143867357-143867379 ACTCAGGAGGCTGAGGAGGAAGG + Intronic
1033771006 7:144551565-144551587 ATTTAGGAGGCTGAGGTGGAAGG + Intronic
1034079001 7:148259245-148259267 ACTCGGTAGGCTAAGGTGGAAGG + Intronic
1034132738 7:148735458-148735480 AGTGAGCAGGCGAAGCAGGAAGG - Intronic
1034233672 7:149552291-149552313 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1034552281 7:151828800-151828822 ACTGAGGAGGCTGAGGTGGAAGG + Intronic
1035787942 8:2277304-2277326 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
1035804868 8:2444409-2444431 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
1036122232 8:6031066-6031088 ATTGAGCAGGTTAATGGGGATGG - Intergenic
1036194917 8:6706017-6706039 CTTCAGGAGGCCAAGGAGGAAGG - Intergenic
1036443924 8:8805521-8805543 ATTGAGGAGGCTGGGGAGGAGGG + Intronic
1036489784 8:9214263-9214285 ATTTAGTAGGCTAAGATGGGAGG + Intergenic
1036532928 8:9613000-9613022 ATTGAGTGGGCTGAGAAGGAGGG + Intronic
1037066284 8:14582025-14582047 GTTGAGTAGGCTGAGGAGGAGGG - Intronic
1037206974 8:16334723-16334745 ATTTGGGAGGCTAAGGTGGAAGG - Intronic
1037208520 8:16355700-16355722 ACTGAGCAGACTGAGGAGGAGGG - Intronic
1037254450 8:16937093-16937115 ACTCAGGAGGCCAAGGAGGAAGG + Intergenic
1037319317 8:17629024-17629046 ACTCAGGAGGCTAAGGAGGGAGG - Intronic
1037728725 8:21505815-21505837 ACTGAGGAGGCTAAGGTGGGAGG + Intergenic
1037759319 8:21731391-21731413 ATTGAGATGGCTACGGATGATGG - Intronic
1037864991 8:22436359-22436381 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
1037912940 8:22754954-22754976 ATCTGGTAGGCTAATGAGGAGGG + Intronic
1038034203 8:23673397-23673419 ATTTGGGAGGCTAAGGTGGAAGG + Intergenic
1038272350 8:26085584-26085606 ATTCAGGAGGCTGAGGTGGAGGG + Intergenic
1038308339 8:26424831-26424853 ACTCAGGAGGCTGAGGAGGAAGG - Intronic
1038429079 8:27485423-27485445 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1038635152 8:29280345-29280367 ACTAAGTAGGCTGAGGAGGGGGG + Intergenic
1038796515 8:30715182-30715204 ATTCAGGAGGCTGAGGCGGAAGG + Intronic
1038954829 8:32456480-32456502 ATGGAGTAGGGTATGGAGGAGGG - Intronic
1039511648 8:38096681-38096703 ACTCAGGAGGCTAAGGTGGAAGG + Intergenic
1039899841 8:41743661-41743683 AGTGAATATGTTAAGGAGGACGG + Intronic
1040035414 8:42865146-42865168 ACTCAGGAGGCTAAGGTGGAAGG + Intronic
1040280719 8:46040595-46040617 CTTCAGGAGGCTAAGGAGAATGG + Intergenic
1040922924 8:52643578-52643600 ATTCGGGAGGCTAAGGAGGGAGG + Intronic
1041058955 8:54017368-54017390 ATTGAATAAGCTGAGGAGAAAGG - Intronic
1041240687 8:55846608-55846630 ATTCAGGAGGCTAAGGTGGGAGG + Intergenic
1041407325 8:57514293-57514315 ACTCAGTAGGCTAAGGTGGGAGG + Intergenic
1042100406 8:65270353-65270375 ATTTGGGAGGCTAAGGAGGGAGG + Intergenic
1042309450 8:67365840-67365862 ATAAAGCAGGGTAAGGAGGATGG - Intergenic
1042647992 8:71008733-71008755 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
1043623940 8:82231098-82231120 ACTAAGTAGGCTGAGGAGGGAGG + Intergenic
1044641601 8:94388245-94388267 ATTGAGTAGGCTAAGAGGAGAGG - Intronic
1044658866 8:94576109-94576131 ATTCTGGAGGCTAAGGAGGGAGG - Intergenic
1045169323 8:99646414-99646436 ATTGAGAAGGCTGAGGTGGGAGG + Intronic
1045213668 8:100125316-100125338 ATTTAATATGGTAAGGAGGAAGG + Intronic
1046281637 8:112040976-112040998 GTTCAGTAGGCTGAGGATGAGGG + Intergenic
1046336976 8:112803417-112803439 ATTGAGTAGGCTCAGGGTTAGGG - Intronic
1047345839 8:124027666-124027688 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1048197812 8:132346929-132346951 ATAGACTAGGCTAAAGTGGAGGG + Intronic
1048425880 8:134323133-134323155 ATTGAGGAGGCTCAGGAGGCAGG - Intergenic
1048507897 8:135037006-135037028 ACTGAGGAGGCTAAGGTGGGAGG - Intergenic
1048651569 8:136484250-136484272 ACTGAATAGGCTGAGGAGGAGGG + Intergenic
1050000244 9:1069931-1069953 ATTGAGTAGGCTTAGGAGGAAGG + Intergenic
1050137192 9:2478710-2478732 CTTTGGTAGGCTAAGGAGGGTGG + Intergenic
1050291586 9:4160998-4161020 CTTAAGAAGGCTAAGGTGGAAGG + Intronic
1050560034 9:6825917-6825939 ACTCAGTAGGCTGAGGTGGAAGG - Intronic
1050996250 9:12221259-12221281 ATTCAGGAGGCTGAGGGGGAAGG + Intergenic
1051238155 9:15023637-15023659 CTTGAGTAGGGAAAGGAGGATGG - Intergenic
1051241253 9:15058746-15058768 CTTTGGTAGGCTAAGGAGGACGG + Intergenic
1051429455 9:16967024-16967046 ATTCAGGAGGCTAAGGTGGGAGG - Intergenic
1051552956 9:18350485-18350507 ATTGAGAAGGGAAAGGAGCAAGG + Intergenic
1052039492 9:23721690-23721712 GTTGAGTAGGCAGAGGAAGAGGG - Intronic
1052099653 9:24429808-24429830 ATAAAGTATGCCAAGGAGGATGG - Intergenic
1052170373 9:25388131-25388153 ATTGCGTAGGCTGAGGAGGAAGG + Intergenic
1052739319 9:32378120-32378142 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
1052847387 9:33349294-33349316 ATACAGAGGGCTAAGGAGGATGG + Intronic
1052861476 9:33440500-33440522 ATAAAGTAGGCTGAGGTGGATGG + Intergenic
1053504644 9:38631272-38631294 ACTGGGGAGGCTAAGGAGGCAGG - Intergenic
1053709596 9:40792420-40792442 CTTTAGGAGGCTGAGGAGGATGG + Intergenic
1054177774 9:61887894-61887916 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
1054419500 9:64913208-64913230 CTTTAGGAGGCTGAGGAGGACGG + Intergenic
1054473371 9:65556025-65556047 ATTCAGAAGGCTGAGGTGGAAGG - Intergenic
1054481777 9:65672500-65672522 CTTTAGGAGGCTAAGGTGGATGG + Intronic
1054659757 9:67692931-67692953 ACTCAGGAGGCTGAGGAGGAAGG - Intergenic
1055073288 9:72189287-72189309 ATTCAGGAGGCTAAGGTGGGAGG - Intronic
1055136222 9:72832062-72832084 ACTCAGGAGGCTGAGGAGGAAGG - Intronic
1055283929 9:74707559-74707581 ACTCAGTAGGCTAAGGTGGGAGG - Intergenic
1055439887 9:76327213-76327235 ACTCAGGAGGCTAAGGTGGAAGG - Intronic
1055443689 9:76361591-76361613 ACTCAGGAGGCTAAGGTGGAAGG + Exonic
1055450880 9:76430488-76430510 ACTGAGGAGGCTGAGGTGGAAGG - Intronic
1055452967 9:76447346-76447368 ATTAAGGAGGCTAAAGTGGAAGG - Intronic
1055607560 9:77986612-77986634 ACTTGGGAGGCTAAGGAGGAAGG - Intronic
1055639149 9:78306004-78306026 ATTTAGGAGGCTAAGGTGGGAGG - Intronic
1055957589 9:81788633-81788655 ATTTGGGAGGCTAAGGTGGAAGG - Intergenic
1056797025 9:89665523-89665545 ACTCAGGAGGCTAAGGTGGAAGG - Intergenic
1056838785 9:89980826-89980848 ACTGAGCAGGCTTAGGAGGTGGG + Intergenic
1056964364 9:91153627-91153649 AATGAGTAGGGAAAGGTGGAGGG + Intergenic
1057187702 9:93066153-93066175 ATTGAGGAGGCTGCAGAGGAGGG - Intronic
1057448909 9:95138796-95138818 AGTGACTATGCTAAGCAGGATGG - Intronic
1057808510 9:98239165-98239187 ACTGTGTAGGCTGAGGTGGAAGG - Intronic
1058617627 9:106850240-106850262 GTTCAGTAGGCTAAGGAGGAGGG - Intergenic
1058660966 9:107268408-107268430 GTTGAGTGGGCTAAGGAGGAGGG - Intergenic
1058718878 9:107745630-107745652 ATTGAGTAGGCTGAGAAGGGAGG - Intergenic
1058738300 9:107917324-107917346 ATTGAGTAGTCTGAGGAGTTTGG + Intergenic
1058995001 9:110291097-110291119 ACTCAGGAGGCTAAGGAGGGAGG - Intergenic
1059081823 9:111258031-111258053 CTTGAGAAGGCTACAGAGGAAGG + Intergenic
1059301250 9:113315248-113315270 ACTCAGGAGGCTAAGGAGGGAGG + Exonic
1059971341 9:119671915-119671937 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
1060640279 9:125232412-125232434 ATTGGGTAGTCCAGGGAGGAAGG - Intronic
1060764127 9:126281192-126281214 ACTGAGGAGGCTGAGGTGGATGG - Intergenic
1061076746 9:128346007-128346029 ATTCAGGAGGCTGAGGTGGAGGG - Intronic
1061435643 9:130559706-130559728 GTTGAGTAGGCTAAGGAGGAGGG + Intergenic
1062663119 9:137650205-137650227 ATTAAGGAGGCTAAGGCGGGAGG - Intronic
1185956584 X:4497686-4497708 ACTTAGGAGGCTAAGGTGGAAGG - Intergenic
1186095834 X:6100897-6100919 ATTGAGAAGGATGAGGAGAAAGG - Intronic
1186347264 X:8706725-8706747 ATTGAAAAGGTTCAGGAGGAGGG + Intronic
1186437211 X:9552897-9552919 CTTGAGGAGGCTGAGGTGGAAGG + Intronic
1186451465 X:9677364-9677386 ATCTAGTAGGCTAAAGAGAAGGG - Intronic
1186836521 X:13443887-13443909 ACTCAGGAGGCTGAGGAGGAAGG + Intergenic
1186925809 X:14332193-14332215 TGGGAGTAGGCTAAGGAGAAGGG - Intergenic
1187159465 X:16751008-16751030 CTTTAGGAGGCTAAGGAGGGCGG - Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187461410 X:19490638-19490660 ATTCAGGAGGCTAAGGTGGGTGG + Intronic
1187538853 X:20170509-20170531 CTTAAGTAGGCTGAGGAGGGAGG - Intronic
1188891224 X:35612421-35612443 ATTGAGTGGGGTAAGGGTGATGG - Intergenic
1190230097 X:48575405-48575427 ATGGTGTAGACTAAGGATGAGGG + Intronic
1191847635 X:65560144-65560166 ATTCAGTAGGCTGAGGTGGGAGG + Intergenic
1192346900 X:70317651-70317673 ACTCAGGAGGCTAAGGAGGGAGG - Intronic
1192489478 X:71562354-71562376 ATTTGGGAGGCTAAGGTGGAAGG + Intronic
1193146654 X:78083621-78083643 ATTCAGGAGGCTGAGGTGGAAGG - Intronic
1193415410 X:81216575-81216597 AATGGGTAGGGTAGGGAGGATGG - Intronic
1193660072 X:84246745-84246767 ATTGGTTAAGATAAGGAGGATGG + Intergenic
1194650367 X:96507169-96507191 GTTGAGTAGGCTGAGGAGGAGGG + Intergenic
1194696583 X:97059772-97059794 GTTGAGTAGGCTGAGAAGGAAGG + Intronic
1195267423 X:103196364-103196386 ATTCAGGAGGCTGAGGTGGAAGG + Intergenic
1195698342 X:107683268-107683290 ATTTAGTGGGGGAAGGAGGAGGG - Intergenic
1195862245 X:109394750-109394772 ATTCAGTATCTTAAGGAGGAAGG + Intronic
1196095956 X:111800205-111800227 GTTGAGTAGGCTGAAGAGGAAGG - Intronic
1196681397 X:118473420-118473442 ATTCAGGAGGCTGAGGTGGAAGG - Intergenic
1197324088 X:125070080-125070102 ACTCAGTAGGCTGAGGAGGGAGG + Intergenic
1197422115 X:126250393-126250415 ATTTAGGAGGCTAAGGGGGGTGG - Intergenic
1197588033 X:128373805-128373827 CTGGAGTAAGCTGAGGAGGAAGG - Intergenic
1197767504 X:130068729-130068751 ATGGAGGAGGCTTAGGAGGATGG + Intronic
1197781031 X:130160659-130160681 ATTCTGGAGGCTAAGGTGGAAGG - Intronic
1197973709 X:132142149-132142171 GTTGAGTAGGCTGAGGGGGAGGG - Intergenic
1198076435 X:133197811-133197833 ATTCAGTAGGCTGAGGTGGGAGG + Intergenic
1198705588 X:139444971-139444993 AGTGAGGAGGCTAAAGAGGCTGG - Intergenic
1198726071 X:139678052-139678074 ACTGGGTAGGCTGAGGTGGAAGG + Intronic
1199900047 X:152164280-152164302 ATTCAAGAGGCTGAGGAGGAAGG - Intergenic
1200809476 Y:7467942-7467964 ATTGAGGAGGTTGAGGAGGAAGG + Intergenic
1201247983 Y:12025673-12025695 GTTGAGGAGGCTAAGCTGGAAGG + Intergenic
1201364769 Y:13191672-13191694 CTTTGGGAGGCTAAGGAGGATGG + Intergenic
1201502842 Y:14664015-14664037 ATTGAGAAGGATGAGGAGAAAGG + Intronic
1201512332 Y:14779015-14779037 ACTCAGGAGGCTAAGGTGGAAGG - Intronic