ID: 1117423354

View in Genome Browser
Species Human (GRCh38)
Location 14:55570541-55570563
Sequence GTGTCATCAAGGATCTACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117423347_1117423354 25 Left 1117423347 14:55570493-55570515 CCAATGCTATCTGCAAACATTTC 0: 1
1: 0
2: 5
3: 45
4: 417
Right 1117423354 14:55570541-55570563 GTGTCATCAAGGATCTACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 96
1117423352_1117423354 -9 Left 1117423352 14:55570527-55570549 CCAAATAAGTTTGCGTGTCATCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1117423354 14:55570541-55570563 GTGTCATCAAGGATCTACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 96
1117423351_1117423354 0 Left 1117423351 14:55570518-55570540 CCTGGGATGCCAAATAAGTTTGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1117423354 14:55570541-55570563 GTGTCATCAAGGATCTACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 96
1117423350_1117423354 1 Left 1117423350 14:55570517-55570539 CCCTGGGATGCCAAATAAGTTTG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1117423354 14:55570541-55570563 GTGTCATCAAGGATCTACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117423354 Original CRISPR GTGTCATCAAGGATCTACTT TGG Intronic
902472665 1:16659594-16659616 GTGTTACCGAGGATCTACTAGGG + Intergenic
904828802 1:33293705-33293727 GTGTCTTCAAGCATCTGTTTGGG - Intronic
908888026 1:68812432-68812454 GTGAAACCAAGAATCTACTTAGG + Intergenic
910211967 1:84802798-84802820 GTATCATCAACAATCTACCTAGG + Intergenic
912427561 1:109608181-109608203 TGGTAATCTAGGATCTACTTAGG - Exonic
914004466 1:143720445-143720467 GTGTTATCAAGGATCTGCTAGGG + Intergenic
914517417 1:148385764-148385786 GTGTTATCAAGGATCTGCTAGGG + Intergenic
920787697 1:209058311-209058333 TTGTCATTAAGGATGCACTTAGG + Intergenic
922476745 1:225911724-225911746 CTGTCCTCAAGGGTCTTCTTAGG + Intronic
924769556 1:247067065-247067087 ATGTCATCAAGGACCTCCTGAGG + Intronic
1062984310 10:1753349-1753371 GTGTCATCAAGCTTCCCCTTGGG + Intergenic
1069270444 10:66520127-66520149 GTGTCATCCATGGTCTACTCTGG - Intronic
1070875910 10:79809540-79809562 GTTTCTTCAGTGATCTACTTAGG + Intergenic
1074444314 10:113506271-113506293 GTGACATCATGGATAAACTTTGG - Intergenic
1074766005 10:116700557-116700579 GTATCATGAAGGATCCACTTGGG - Intronic
1077942029 11:6852907-6852929 TTGTCTTCAAGTATCTACTTTGG - Intergenic
1081283528 11:41240662-41240684 GGGTCATGAAGGACCTACATGGG + Intronic
1083717476 11:64586124-64586146 GTGGCATCATGGAGCGACTTGGG - Intergenic
1088651751 11:111963493-111963515 GTTTCATTAAGGAAGTACTTGGG + Intronic
1089547421 11:119239944-119239966 GAGTCAACAAGTTTCTACTTTGG - Intronic
1091738584 12:2943421-2943443 GTGTCACAAAGAATCTATTTGGG - Intergenic
1093224188 12:16461462-16461484 GAGTCATAAAGGATCATCTTTGG - Intronic
1095867625 12:46990135-46990157 GTGTCATCTATGATCTCTTTTGG - Intergenic
1097004535 12:55906336-55906358 GTATCATCAATGATATCCTTAGG + Intronic
1098656870 12:73042281-73042303 GAGGCATCAAGCATTTACTTAGG - Intergenic
1106069949 13:26400652-26400674 TTGTCATAAAGGATTTCCTTGGG - Intronic
1108456039 13:50614667-50614689 GTGCCATCAGGGAGCTACTCAGG + Intronic
1110116726 13:71826746-71826768 GAGTCCTCAAGGATCTACTTCGG - Intronic
1110210105 13:72961744-72961766 GTGTCAGCAAGCTCCTACTTTGG - Intronic
1110898369 13:80786799-80786821 TTGTCATCAAGGGTGTATTTAGG - Intergenic
1115748103 14:36459218-36459240 GGGTCAGCATGGATCTACCTTGG + Intergenic
1117423354 14:55570541-55570563 GTGTCATCAAGGATCTACTTTGG + Intronic
1119277060 14:73367485-73367507 GTGTCAAGAAGGATCAATTTGGG + Intronic
1122757327 14:103992528-103992550 GTATCAACATGGCTCTACTTGGG - Intronic
1125700723 15:41680946-41680968 GTGCCATCCTGGATCTATTTAGG + Intronic
1128703390 15:69820890-69820912 GTGGCATCAAGGATCCAGCTGGG + Intergenic
1130371292 15:83286671-83286693 TTGTCATCAAGGATCTCTCTTGG - Intergenic
1131735582 15:95327822-95327844 GTGTCATCCGGGCTCTTCTTTGG + Intergenic
1148887618 17:50785277-50785299 GTGGCAGCAAGGATGTCCTTGGG - Intergenic
1149318785 17:55463769-55463791 GTGACCTCAAGTACCTACTTTGG - Intergenic
1156399005 18:36724197-36724219 GTCTCACCAAGGATCCACCTGGG + Intronic
1157167304 18:45369967-45369989 GTTTCATAAAGGATCCAGTTTGG - Intronic
1159114031 18:64092839-64092861 ATTTCATTAAGGATGTACTTGGG + Intergenic
1159794067 18:72821014-72821036 GTGTATTCAAGGTTCTAATTAGG - Intronic
929786004 2:44991983-44992005 GTATCATCATGGATCTCTTTGGG + Intergenic
942586327 2:177483025-177483047 TTGTCCTCAAGATTCTACTTGGG - Intronic
943981944 2:194564243-194564265 GAGTCATAAAAGATTTACTTTGG - Intergenic
946467628 2:219926160-219926182 GAGCCTTCAAGGATCTAGTTAGG - Intergenic
1169226039 20:3857624-3857646 GTGTCTTCCAGGATCGACTGCGG + Exonic
1172066145 20:32222000-32222022 GTGTCATCAAGAATCCAGCTGGG + Intronic
1172748323 20:37230978-37231000 GTGTCATCATGGAGCTGGTTTGG + Intronic
1178355848 21:31910116-31910138 GTTTCATAAAGGTTCTGCTTTGG + Intronic
951632296 3:24735257-24735279 CTGTCATGAAGGGGCTACTTGGG - Intergenic
957484821 3:80845949-80845971 GTGACAACAAGGATGAACTTAGG - Intergenic
957685022 3:83492057-83492079 GTGTCATCTAGGCTCTCCTAGGG - Intergenic
960662974 3:120080887-120080909 TTTTCATCATGGATGTACTTAGG - Intronic
963359068 3:144247152-144247174 GTGTCATTCAGGATCTATGTGGG + Intergenic
963465989 3:145683975-145683997 GTGTCATCATGAAGATACTTTGG - Intergenic
964265631 3:154891921-154891943 GTGTCATCTTGGATCTTCTCAGG + Intergenic
964778976 3:160314368-160314390 GAGACATCAAGGATCTCTTTTGG + Intronic
970407232 4:15775424-15775446 GAGGCATCAAGGAGCCACTTGGG - Intergenic
975966455 4:79978144-79978166 GGGTGATAAAGGATCTACTGAGG - Exonic
978295937 4:107205196-107205218 GGGTCAGCAAGGAGCTACTCAGG + Intronic
980707259 4:136515375-136515397 GTTTCATCAAGGTTATATTTCGG + Intergenic
984036172 4:174670759-174670781 ATTTCATCAAGGACCTACTTAGG - Intronic
993746180 5:91600001-91600023 ATGTGTTCAAGGATCTTCTTTGG + Intergenic
994121105 5:96113809-96113831 GAGTCATCAAGGATTGACTAAGG - Intergenic
995217796 5:109614999-109615021 GGGTCTTCAAGTCTCTACTTAGG + Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
998307955 5:141097188-141097210 GTGTTAATAAGGATCTACTGAGG + Exonic
1001495711 5:172186806-172186828 CGGTCATCTAGGAACTACTTCGG + Intronic
1007448936 6:41928448-41928470 ATGTCATAAAGTATGTACTTGGG + Intronic
1008044733 6:46840150-46840172 TTGTCATAAAGTCTCTACTTAGG - Intergenic
1008466578 6:51837773-51837795 GTCTCATCATGGATCTCTTTGGG - Intronic
1009440101 6:63667656-63667678 TTGTAATCAAGGACCTAGTTTGG + Intronic
1013639898 6:112063984-112064006 GTGCCATCAAGGACATTCTTAGG + Intronic
1016279017 6:142392036-142392058 CTGTTATCAAGTATCTGCTTTGG - Intronic
1020558553 7:9699806-9699828 GTGAAATGAAGAATCTACTTGGG + Intergenic
1021820404 7:24492460-24492482 TTGTGATAAAGCATCTACTTGGG - Intergenic
1032331659 7:130986339-130986361 GTTTCATCAAGGACTTCCTTTGG - Intergenic
1032532476 7:132633624-132633646 GTGTCATCAAGGATATATTCAGG + Intronic
1032881366 7:136094035-136094057 GGGTGATCAATGATCTGCTTTGG - Intergenic
1033497219 7:141911101-141911123 TTGTGATCAAGGAAGTACTTAGG + Intronic
1034759082 7:153654422-153654444 GGGTCATCAGGGAGCTCCTTGGG - Intergenic
1035142824 7:156781302-156781324 CTGTCATAAAGGATCTTCTGTGG - Intronic
1038835571 8:31117499-31117521 GTGTCATAGAGGATTTATTTGGG + Intronic
1039939497 8:42077413-42077435 ATGTCTTCAAGGATATATTTGGG - Intergenic
1040795197 8:51283086-51283108 GTGTTATCAATTATCTTCTTAGG - Intergenic
1043220965 8:77663246-77663268 TTAGCATAAAGGATCTACTTGGG - Intergenic
1043576291 8:81662023-81662045 TTGGCATAAAGGATGTACTTAGG - Intronic
1046530320 8:115437071-115437093 GTGCCATCTAGTATTTACTTTGG + Intronic
1048536652 8:135302644-135302666 GGGTCATCAGGGGTCCACTTGGG + Intergenic
1049928421 9:432246-432268 TTGTCCTCAAGGATCTTCTCAGG - Exonic
1050496974 9:6253309-6253331 GTGGCATAAAGGTTGTACTTTGG - Intronic
1053652854 9:40186741-40186763 TTGTCATAAAGTCTCTACTTAGG + Intergenic
1053903257 9:42816048-42816070 TTGTCATAAAGTCTCTACTTAGG + Intergenic
1054531727 9:66189480-66189502 TTGTCATAAAGTCTCTACTTAGG - Intergenic
1056053108 9:82790903-82790925 ATGTAATGATGGATCTACTTTGG + Intergenic
1056623423 9:88234386-88234408 GGGTAATCAAGGATCTACCGTGG + Intergenic
1059008391 9:110429312-110429334 GTGTAATAAAGGATATACTCTGG - Exonic
1059051276 9:110929031-110929053 GTGTCAACAAAAGTCTACTTGGG + Intronic
1186476513 X:9861932-9861954 GTATCAGCCAGGATCTAGTTAGG + Intronic
1188938004 X:36201197-36201219 TTGTCATCCAGGATGGACTTGGG - Intergenic
1198480928 X:137039880-137039902 GGGTCATAAAGAATCTTCTTGGG + Intergenic