ID: 1117424522

View in Genome Browser
Species Human (GRCh38)
Location 14:55580527-55580549
Sequence GCGGGGCTCTTGTTGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117424506_1117424522 15 Left 1117424506 14:55580489-55580511 CCGCCCGCTGGGTAGGCCTCGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1117424522 14:55580527-55580549 GCGGGGCTCTTGTTGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1117424508_1117424522 12 Left 1117424508 14:55580492-55580514 CCCGCTGGGTAGGCCTCGGGCAT 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1117424522 14:55580527-55580549 GCGGGGCTCTTGTTGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1117424503_1117424522 22 Left 1117424503 14:55580482-55580504 CCGGACGCCGCCCGCTGGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1117424522 14:55580527-55580549 GCGGGGCTCTTGTTGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1117424502_1117424522 23 Left 1117424502 14:55580481-55580503 CCCGGACGCCGCCCGCTGGGTAG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1117424522 14:55580527-55580549 GCGGGGCTCTTGTTGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1117424509_1117424522 11 Left 1117424509 14:55580493-55580515 CCGCTGGGTAGGCCTCGGGCATC 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1117424522 14:55580527-55580549 GCGGGGCTCTTGTTGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1117424511_1117424522 -1 Left 1117424511 14:55580505-55580527 CCTCGGGCATCCGGTTGCCGCCG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1117424522 14:55580527-55580549 GCGGGGCTCTTGTTGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117424522 Original CRISPR GCGGGGCTCTTGTTGGGGCC GGG Intronic