ID: 1117427619

View in Genome Browser
Species Human (GRCh38)
Location 14:55617465-55617487
Sequence AGATGTGCCATGGAAATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117427615_1117427619 20 Left 1117427615 14:55617422-55617444 CCTTCTTCCACTTTTAATGTATT 0: 1
1: 0
2: 5
3: 63
4: 675
Right 1117427619 14:55617465-55617487 AGATGTGCCATGGAAATTAGAGG 0: 1
1: 0
2: 2
3: 10
4: 169
1117427617_1117427619 13 Left 1117427617 14:55617429-55617451 CCACTTTTAATGTATTTTGGAAG 0: 1
1: 0
2: 2
3: 35
4: 390
Right 1117427619 14:55617465-55617487 AGATGTGCCATGGAAATTAGAGG 0: 1
1: 0
2: 2
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117427619 Original CRISPR AGATGTGCCATGGAAATTAG AGG Intronic
903624269 1:24720067-24720089 AGATGAGCCATGGATACCAGTGG - Intergenic
905826404 1:41028780-41028802 AGATGTGCCAAGGAGAGTGGTGG - Intronic
907522098 1:55030623-55030645 AGGTGTCACATGGAACTTAGGGG - Intergenic
907660224 1:56384900-56384922 AGATTTGCCATGGGAATAAATGG - Intergenic
908185675 1:61650505-61650527 AGTTTTGCCATTGAAATTAATGG + Intergenic
909027646 1:70501525-70501547 AGAGGGGCTAGGGAAATTAGGGG + Intergenic
913357485 1:117939099-117939121 AGTTATGCAATGGACATTAGTGG + Intronic
915117229 1:153608584-153608606 GGATGAGCCATGGAGGTTAGGGG + Intronic
918191579 1:182180480-182180502 AGTTTTGCCATTGAAATTAATGG - Intergenic
918882556 1:190144123-190144145 AAATGTGCCAAGAAAATTACAGG + Intronic
920721223 1:208388833-208388855 AAATCTGCCATAGAATTTAGGGG + Intergenic
920951287 1:210573905-210573927 AGATGAACCAGGGAAATGAGAGG + Intronic
921974948 1:221192100-221192122 AAATGTGCCTTGGAAATGAAAGG - Intergenic
1063077611 10:2732536-2732558 AGAGGTGCCAAGCAAATTATTGG - Intergenic
1063207542 10:3848886-3848908 AGAGTTGCCATGGACATTTGAGG + Intergenic
1064482171 10:15750573-15750595 AGGTGAGCCATTGAAATCAGAGG + Intergenic
1064953824 10:20884377-20884399 AAATGTGGCATTGAAATTGGGGG + Intronic
1066699820 10:38115241-38115263 CGAGGAGCCATGGATATTAGAGG + Exonic
1067123628 10:43496481-43496503 AGAGGAGGCATGGATATTAGAGG + Intergenic
1067475621 10:46564053-46564075 AGTTGTGCCATGGAAGGCAGTGG + Intergenic
1067619115 10:47777722-47777744 AGTTGTGCCATGGAAGGCAGTGG - Intergenic
1068345783 10:55776146-55776168 AGAAGTGCCAAGCAAAATAGGGG - Intergenic
1068730654 10:60354191-60354213 AGATGTGCCATGCATCTTGGGGG - Intronic
1069605956 10:69738752-69738774 AGTTGTGCTATGGAAATTAAAGG + Intergenic
1070144477 10:73763889-73763911 AGATGTGCAAGGGATATTATAGG - Exonic
1070403164 10:76071106-76071128 AGATTCGCCAAGGGAATTAGAGG - Intronic
1070691148 10:78527100-78527122 TGATGTCCCATGGAAAAAAGTGG + Intergenic
1071148205 10:82599878-82599900 AGAAATGACATGGAAAGTAGTGG + Intronic
1074065554 10:110009131-110009153 ACATGTGCCAAGGAAATTAGTGG - Intronic
1076357708 10:129865080-129865102 AGATGTGCCAAGGGACTCAGGGG + Intronic
1077021349 11:418461-418483 AGATGTGGCATGGAAGGCAGAGG - Exonic
1077758372 11:5061264-5061286 AGAAATGCCATGTAAATTATTGG + Intergenic
1084356525 11:68642180-68642202 TGATGTGCCGTGGAAATTCGCGG - Intergenic
1086070387 11:82792944-82792966 AGATGTGCCAAGGAGATTAGTGG - Intergenic
1089626359 11:119753643-119753665 AGATGTGCCATAGAGTGTAGTGG - Intergenic
1093645346 12:21579735-21579757 AGATGTGCCAATGAAAGCAGAGG - Intronic
1095351740 12:41221829-41221851 AGTTGTGCCAGGAAAGTTAGGGG - Intronic
1097861226 12:64520768-64520790 AGATGACCGATTGAAATTAGAGG + Intergenic
1099255007 12:80304953-80304975 AGAGGTCCCATGGTAATAAGTGG - Intronic
1099467767 12:83008107-83008129 AGATTTGCCATTGAAAGTAATGG + Intronic
1099848018 12:88054443-88054465 AGGTTTGCCATGGAAATATGAGG + Intronic
1104056416 12:125234330-125234352 GGAAGCGCCATGGAAAATAGGGG - Intronic
1108913591 13:55582859-55582881 GGATGGGGCATGGAAATAAGGGG + Intergenic
1109843781 13:67956763-67956785 AGATGTGGCATTGAAATCAGAGG - Intergenic
1112274138 13:98000390-98000412 AAATGTGGAATTGAAATTAGGGG - Intronic
1112384022 13:98921287-98921309 AAATGACCCATGGATATTAGGGG - Intronic
1112995651 13:105571858-105571880 AAAGGTGCCATGGAAATTTTTGG + Intergenic
1113571692 13:111362466-111362488 GCATGTGCAATGGAAATTATGGG + Intergenic
1115054962 14:29112940-29112962 GGATGTGTCATGGAAAATATTGG - Intergenic
1115272571 14:31570593-31570615 AAATGTGGCAAGGATATTAGGGG - Intronic
1116552589 14:46260811-46260833 AGATGTGACATGGGAAGCAGAGG - Intergenic
1117427619 14:55617465-55617487 AGATGTGCCATGGAAATTAGAGG + Intronic
1121478172 14:94233662-94233684 AGTTGTGCCTTGGAAACAAGTGG - Exonic
1122683717 14:103487603-103487625 AGATGTGCCAAGAAAAGCAGGGG - Intronic
1124524002 15:30431259-30431281 AAATGTGCAATGGAATGTAGTGG - Intergenic
1124534664 15:30534957-30534979 AAATGTGCAATGGAATGTAGTGG + Intergenic
1124763985 15:32472642-32472664 AAATGTGCAATGGAATGTAGTGG - Intergenic
1124774642 15:32576405-32576427 AAATGTGCAATGGAATGTAGTGG + Intergenic
1126041939 15:44599914-44599936 ACATGTGCCATGGCAGTTTGTGG + Intronic
1127238197 15:57079783-57079805 AAAAGTGCTATGGAAATGAGAGG + Intronic
1129373810 15:75114985-75115007 AGATGTGCAATGGAAAACAGTGG + Intronic
1131648358 15:94371384-94371406 ACATGTGCCTTTGACATTAGTGG + Intronic
1131843346 15:96462315-96462337 AGGTGTCCCAAGGAAGTTAGTGG - Intergenic
1134173855 16:11990410-11990432 AGGTGAGGCATGGAAATGAGCGG - Intronic
1135353861 16:21753192-21753214 TGATGGGCCTTGGAATTTAGAGG + Intronic
1135452350 16:22569330-22569352 TGATGGGCCTTGGAATTTAGAGG + Intergenic
1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG + Intronic
1138871259 16:60889852-60889874 TGATGTACCATCAAAATTAGAGG + Intergenic
1139680544 16:68558519-68558541 AGAAGAGCCATGGATATCAGAGG + Exonic
1142399636 16:89852336-89852358 AGATGGGCCATGGAATATGGGGG - Intronic
1148133944 17:45279849-45279871 AGATGTCCAATGAATATTAGAGG + Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153495030 18:5689214-5689236 ACATGTGCCATGGTGATTTGTGG + Intergenic
1154944028 18:21143159-21143181 AGATGTACCATGTATATTCGTGG - Intergenic
1155556919 18:27030073-27030095 GGAAGTGCCAAGGAAATTAACGG - Intronic
1159835725 18:73332851-73332873 TGATGAGCCATTGAACTTAGAGG - Intergenic
1164941598 19:32255500-32255522 AGATGTGCCAGGGAAGGTAGTGG - Intergenic
1167180396 19:47898768-47898790 AGATTTGCCATTGAAAGTAATGG - Intergenic
925544357 2:5002038-5002060 AGTTGGGGCATGGAAATAAGGGG - Intergenic
925626249 2:5844285-5844307 ATATTTCCCATGGAATTTAGAGG + Intergenic
926472925 2:13283941-13283963 TAATGTGGCATTGAAATTAGTGG + Intergenic
929127468 2:38534804-38534826 ATAGGTGCCATAGAAATCAGAGG - Intergenic
929810770 2:45187820-45187842 AGAAGTGGCTTGGAAATTTGAGG - Intergenic
932440299 2:71730708-71730730 AGATTTGCTCTGGAAATGAGAGG - Intergenic
932800350 2:74736649-74736671 ACATGTTCCATGAAAATGAGAGG - Intergenic
932914967 2:75847311-75847333 AGATGAGTCATGGAACTGAGTGG - Intergenic
935217745 2:100988195-100988217 AGATCTGCCCTGGAAGTTGGGGG - Exonic
935883253 2:107587991-107588013 AGATGCTCCATAGAAATAAGTGG + Intergenic
936066116 2:109333552-109333574 AGAGATTCCATGTAAATTAGTGG - Intronic
937794518 2:126000947-126000969 CAATGTGCAATGGAAATGAGTGG + Intergenic
938387014 2:130873816-130873838 AGATGGACCAGGGAACTTAGGGG - Intronic
941619639 2:167762016-167762038 AGATTTGACTTGGAAATTATCGG + Intergenic
945277270 2:208000493-208000515 AGATGGGCCATTGAAATTGTGGG - Intronic
946993081 2:225358312-225358334 AAATGTGCAATTGCAATTAGTGG - Intergenic
948689827 2:239694871-239694893 AAATATGCCACGGAATTTAGGGG + Intergenic
1168861245 20:1047500-1047522 GGATGTGCCAGGGCAATGAGTGG - Intergenic
1169142903 20:3236143-3236165 GGATGTGCCAAGGAAACTGGCGG - Intronic
1169514817 20:6304115-6304137 AAGTGTGCCCAGGAAATTAGGGG - Intergenic
1173349161 20:42228968-42228990 ATATGGTCCATGGAAATTGGAGG + Intronic
1173743607 20:45419769-45419791 ATATTTGTCATGGAAAATAGTGG + Intronic
1175695797 20:61101869-61101891 AGGTGTGACATAGGAATTAGAGG - Intergenic
1179144254 21:38753138-38753160 AGAATTGCCTTGGGAATTAGTGG - Intergenic
1179246074 21:39635297-39635319 AGATGTGCCATGGAGAGTGAAGG + Intronic
1179528689 21:42002697-42002719 AGATGAGCCGTGGAAAGGAGGGG - Intronic
1181684513 22:24519438-24519460 AGATATGACATGGAATCTAGTGG - Intronic
1203305958 22_KI270736v1_random:109341-109363 AGAAGTGGAATGGAGATTAGTGG + Intergenic
950764905 3:15266416-15266438 AAATGTGACTTGGAAATGAGAGG - Intronic
952081065 3:29757774-29757796 AAATGTGCCATGGTAATTTAAGG - Intronic
952144887 3:30521439-30521461 AAATGTGCCATGGTCAATAGGGG - Intergenic
956492121 3:69784201-69784223 AGATTTGCTATGGAAAATAGTGG - Intronic
962951118 3:140219806-140219828 GGATGTGCTATGTAAAATAGTGG + Intronic
963474392 3:145785906-145785928 GAATGTGCCTTGGAGATTAGAGG + Intergenic
964394256 3:156228898-156228920 AGGTATGCCATGGAACTCAGAGG - Intronic
967405773 3:189114789-189114811 AGAAATGCTATAGAAATTAGTGG + Intronic
970311457 4:14786716-14786738 CTATGTGCCAGGGAAATGAGGGG - Intergenic
970434423 4:16019663-16019685 AGATGTGAAATTTAAATTAGAGG + Intronic
970971524 4:21989785-21989807 AGATGTCCCATGGAAAACAAGGG + Intergenic
978506727 4:109465700-109465722 AGATGTGTCAGGGAAATATGGGG + Intronic
978642978 4:110893178-110893200 ACATGTGCCATGGTGATTTGAGG - Intergenic
979741037 4:124151363-124151385 CTATGTGTCATGAAAATTAGTGG - Intergenic
980465148 4:133166978-133167000 AGATGGGCCATGAAAATAAATGG - Intronic
981138390 4:141238672-141238694 TAATATGCCATGGGAATTAGGGG + Intergenic
981222151 4:142249303-142249325 AGATTTGGCATGGTAATTTGAGG + Intronic
982018621 4:151181075-151181097 ATATGTTCCATGAAAAATAGAGG - Intronic
987119541 5:14753831-14753853 AGAATTGCCATTGAAATTTGAGG + Intronic
987961348 5:24813504-24813526 TGAGGTGCCATGAAAGTTAGGGG + Intergenic
989156493 5:38349396-38349418 AGATGTGCTCAGGAAATGAGTGG - Intronic
989377843 5:40783849-40783871 ACATGTGCAATTGGAATTAGGGG - Intronic
990729210 5:58789977-58789999 AGATGTGGCTTGGACATTATGGG + Intronic
990940027 5:61192799-61192821 AGAGGTGCGCTGGAAATTTGAGG - Intergenic
992503498 5:77364005-77364027 TGATGTGCCATGGAAGGGAGTGG + Intronic
993869861 5:93239876-93239898 ATGGGTGGCATGGAAATTAGAGG - Intergenic
994793099 5:104257607-104257629 AGATGGGCCATGGAGTTTATGGG + Intergenic
998491585 5:142551649-142551671 AGAAGGGCCCTGGAAATTATGGG - Intergenic
998827993 5:146124873-146124895 TGATTTGCCAGGCAAATTAGTGG - Intronic
1000754213 5:165136290-165136312 AGATGTGTAATTGAGATTAGGGG - Intergenic
1003436538 6:6094014-6094036 ATATGTGCAATACAAATTAGGGG + Intergenic
1005206147 6:23407340-23407362 AGATGTGGCTAGGAAATTAATGG - Intergenic
1006577564 6:35057451-35057473 AGATGAGCCCTGGAAAAGAGAGG - Intronic
1007259909 6:40556186-40556208 GGAGGAGCCATGGAAATCAGAGG + Intronic
1008448432 6:51620860-51620882 AGATGTGTCATGGAAATAATAGG - Intronic
1009764957 6:68060641-68060663 ACATGTGACATGGGAATTTGTGG + Intergenic
1010552363 6:77238354-77238376 AGAAGTTCCCTGGAATTTAGTGG - Intergenic
1013029682 6:106321281-106321303 AGAGGGGCCATGGAAATATGAGG - Intronic
1017088464 6:150736898-150736920 AAATCTGAGATGGAAATTAGGGG + Intronic
1017489594 6:154933348-154933370 AGATATGCCATGAAAGTTTGAGG - Intronic
1018296613 6:162352852-162352874 ATAGGTGCCATGTAAATTTGGGG - Intronic
1023168584 7:37367883-37367905 ATGTCTGCCATGGATATTAGTGG - Intronic
1025060282 7:55799555-55799577 AGATATTCCATGCAAATTATAGG + Intronic
1027999369 7:85471789-85471811 AGATGTGTGATGGAAAAGAGAGG + Intergenic
1028598786 7:92578025-92578047 AGATGAGTCAAGGAACTTAGAGG - Intronic
1028600769 7:92598062-92598084 AGATATTCCAGGGAAGTTAGTGG - Intergenic
1029815168 7:103086146-103086168 AGATGTTCCATAAAAATAAGGGG - Intronic
1032340531 7:131068392-131068414 AGAAGTGCAATGGAAAAAAGTGG + Intergenic
1036282882 8:7416744-7416766 AGATGGGCCAGGGAAATAGGAGG - Intronic
1036338587 8:7894774-7894796 AGATGGGCCAGGGAAATAGGAGG + Intronic
1036341546 8:7919313-7919335 AGATGAGTCAGGGAAATAAGAGG + Intergenic
1036563010 8:9913506-9913528 AGATGAGCCATGGATGTTTGGGG + Intergenic
1037654181 8:20868629-20868651 AGAGGTTCCAAGGAAATGAGAGG + Intergenic
1037659014 8:20911390-20911412 AGGTGTGCCAATGAAGTTAGGGG - Intergenic
1044027223 8:87188239-87188261 CTATGTGTCATGGAAAGTAGTGG - Intronic
1045435498 8:102159440-102159462 AAATGTCCCATAGATATTAGAGG - Intergenic
1045559825 8:103250301-103250323 AGAAGTGCATTGGCAATTAGAGG - Intergenic
1048081509 8:131133187-131133209 AGTTGAGCCATGGATATTTGAGG - Intergenic
1048232897 8:132660969-132660991 CGATTTGGAATGGAAATTAGAGG - Intronic
1048949335 8:139481559-139481581 TTATGTGCAATGAAAATTAGTGG + Intergenic
1049138096 8:140924101-140924123 GGTTGTGCCAAGGAAACTAGGGG - Intronic
1050060116 9:1699513-1699535 AGAAATGCCCTAGAAATTAGGGG - Intergenic
1058918500 9:109590689-109590711 AGATGTGCCCTGGAGGCTAGTGG - Intergenic
1059986855 9:119828615-119828637 TCATGTGCCATGGGAATGAGAGG - Intergenic
1061902154 9:133678436-133678458 AGATGGGTCATGGACAGTAGAGG + Intronic
1186448130 X:9649580-9649602 AGATGTATAATGCAAATTAGAGG + Intronic
1187553545 X:20329558-20329580 TGATGTTCCATGAAAATAAGTGG - Intergenic
1190130967 X:47748684-47748706 AGATTTGCCATGGCAGTTAGTGG - Intergenic
1190142090 X:47856461-47856483 TTATGTGCCAAGGAAATTAAAGG + Intronic
1191669739 X:63738117-63738139 AGATGTGCTGTGGAAAGTAGAGG - Intronic
1196737344 X:118991440-118991462 TGTTGTGCCATGAATATTAGTGG + Intronic
1197269841 X:124413528-124413550 AGATGTGCTATGGAGTTCAGCGG + Intronic
1198585441 X:138115620-138115642 AGATGAGCAAGGGAAATGAGAGG + Intergenic
1198632844 X:138660786-138660808 ATATTTGCCATAGAAAATAGAGG - Intronic
1200766517 Y:7084830-7084852 ACATGTGCAAGGGAAATGAGAGG - Intronic
1201961204 Y:19682359-19682381 AGAAGTGCCATGCAAATTCCAGG + Intergenic