ID: 1117431134

View in Genome Browser
Species Human (GRCh38)
Location 14:55662828-55662850
Sequence CAAGTTCACCTCAAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117431134_1117431136 17 Left 1117431134 14:55662828-55662850 CCACAAAACTTGAGGTGAACTTG 0: 1
1: 0
2: 3
3: 15
4: 132
Right 1117431136 14:55662868-55662890 TCTTAACTGTGTTTTATTATTGG 0: 1
1: 0
2: 5
3: 36
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117431134 Original CRISPR CAAGTTCACCTCAAGTTTTG TGG (reversed) Intronic
902429912 1:16354828-16354850 CAAGTTCCCCTCAAGTTGGAGGG + Intronic
904194086 1:28771447-28771469 CACATTTACCTCAAATTTTGGGG + Intergenic
906078804 1:43070188-43070210 CAACTTCACCTCTATTTTGGGGG + Intergenic
911346990 1:96708985-96709007 CAAGTTTACTTCAAGTTTTGGGG - Intergenic
922042751 1:221912956-221912978 CAATTGTTCCTCAAGTTTTGAGG - Intergenic
924798622 1:247310823-247310845 CAATTTCAACACAAATTTTGGGG + Intronic
1068239098 10:54281095-54281117 TAATTTCATATCAAGTTTTGGGG - Intronic
1069101864 10:64332082-64332104 CAAGTTTACCTAAGTTTTTGAGG + Intergenic
1070672969 10:78390745-78390767 CACGTTCACCTCAATCATTGAGG - Intergenic
1070783879 10:79152074-79152096 CAAGGTCACCTCTGGTGTTGGGG - Intronic
1070892614 10:79952774-79952796 CCACTTCAACTCAGGTTTTGGGG + Intronic
1073380252 10:103072788-103072810 CCAGTTCAGGTCAGGTTTTGTGG - Intronic
1078246889 11:9581856-9581878 AAAGTTTATCTCAAATTTTGGGG - Intronic
1078759332 11:14239155-14239177 CAAGTTCTCCTGAGGCTTTGTGG + Intronic
1079718918 11:23786438-23786460 CAATTTCAGCACAAGTTTTAGGG + Intergenic
1081490887 11:43567744-43567766 CAATTTCATCTAATGTTTTGGGG + Intronic
1083915611 11:65741551-65741573 CAAGCTCAGCCCCAGTTTTGGGG - Intergenic
1087996182 11:104812159-104812181 AAAGATCTCCTCAAGTTTCGAGG - Intergenic
1089016876 11:115172599-115172621 CAGGGTCACTTCAAGTTTTCAGG + Exonic
1089572404 11:119419296-119419318 CCACTTCTCCTCAAGGTTTGAGG + Exonic
1089841189 11:121419221-121419243 CAAGCTAAGCTCCAGTTTTGGGG + Intergenic
1090193712 11:124797766-124797788 CAAGTTGACCTCAAGCTCTTAGG - Intronic
1094194470 12:27732215-27732237 GTTATTCACCTCAAGTTTTGTGG + Intronic
1095286918 12:40423637-40423659 CAATTTCACCTCCAATTTTTAGG + Intronic
1095668627 12:44833065-44833087 CAATTCCACCACCAGTTTTGGGG + Intronic
1098304397 12:69087935-69087957 CAAGTTCACAGCATCTTTTGTGG - Intergenic
1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG + Intergenic
1098998342 12:77147670-77147692 CTACTTCACCTCAAATTTTGGGG + Intergenic
1102058691 12:109915749-109915771 CAAAATCACTTCAAGGTTTGAGG - Intronic
1102443037 12:112978204-112978226 TTAGTTAACCTCAAGTTTTGGGG + Intergenic
1103414414 12:120734364-120734386 CAAGTGCACATCAAGCTCTGCGG - Intronic
1104344231 12:127981544-127981566 GAAGTTCACCTGAAGTTATTAGG + Intergenic
1104859724 12:131917808-131917830 CCTGCTCACCTCATGTTTTGGGG - Intronic
1106978762 13:35252864-35252886 CAAGTCCATCCCAAGTTTTAGGG - Intronic
1108667182 13:52644441-52644463 CAAGTTCAGCTTAAGTTGTTTGG + Intergenic
1110076566 13:71252652-71252674 CAAGTTTATCTCAAGCTTTTGGG + Intergenic
1110840291 13:80134392-80134414 CAAATTCACCTCCTTTTTTGGGG - Intergenic
1111770920 13:92594533-92594555 AAAGTTCACCTTCAGTTTTGAGG + Intronic
1114696947 14:24634260-24634282 CATGTTCCCCTCTGGTTTTGTGG + Exonic
1117431134 14:55662828-55662850 CAAGTTCACCTCAAGTTTTGTGG - Intronic
1118357568 14:65027330-65027352 GAGGTTCCCCTCAACTTTTGAGG + Intronic
1118676065 14:68185831-68185853 GAAGTTCACCTCCTGTTGTGTGG + Intronic
1119099845 14:71869746-71869768 CAATTTCAACACAAGTTTTGAGG - Intergenic
1119524321 14:75310270-75310292 AATGTTCACCTCAAATTTTGGGG - Intergenic
1128067816 15:64775477-64775499 CAGGGTCACATCAAGTTTGGCGG + Exonic
1128705475 15:69834862-69834884 CAAGGTCTCCTGAAGGTTTGGGG - Intergenic
1132193454 15:99890521-99890543 AAAGTTCACCTTCAGTTTTGAGG - Intergenic
1132503629 16:296268-296290 CAAGTTCTCATCAAGTAATGTGG + Intronic
1141701601 16:85644905-85644927 AAAGTTCACTTTAAGTTTTTGGG - Intronic
1141926250 16:87171766-87171788 CCAGTGCACCTCAAGTGTTACGG - Intronic
1149295416 17:55257659-55257681 CAAGTTCTCCCCAGGTTTTCAGG + Intergenic
1149830256 17:59865719-59865741 CAAGTTCAGTTAAAGTTTAGGGG - Intronic
1149955786 17:61048145-61048167 CAATTTGATCTCAAATTTTGGGG + Intronic
1151320205 17:73348412-73348434 CAAGTTCTGCTCAAAGTTTGCGG - Intronic
1154159955 18:11973689-11973711 TAATTTCAACTCAAGTGTTGTGG + Intergenic
1155012805 18:21798077-21798099 CAACTTTACCTAAAGTCTTGGGG - Exonic
1155489176 18:26382072-26382094 TAAATTCACCTTTAGTTTTGAGG + Intronic
1158304648 18:56091564-56091586 CCATTTCATCTCATGTTTTGGGG + Intergenic
1164247435 19:23444579-23444601 TACGTTCACCTGAGGTTTTGGGG - Intergenic
1166731903 19:45064084-45064106 CACGTTCATCACCAGTTTTGGGG + Exonic
1167408775 19:49332669-49332691 TAAGGTCACCACAAGTTCTGGGG + Intergenic
927446489 2:23166572-23166594 CCAGATCACCTCTACTTTTGGGG - Intergenic
930315095 2:49787517-49787539 CCTGTTCACCTCAAGTTTTCTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
943455055 2:188095821-188095843 CAAGTACACCTCTAGTTTTATGG - Intergenic
943883641 2:193182173-193182195 CAAGTTAAGCTCTAATTTTGGGG + Intergenic
947255134 2:228155045-228155067 CAAGTTAACCTCAATTATTGTGG + Intronic
1180992298 22:19943989-19944011 CAAGTTTATATCAAGTTTTCCGG + Intronic
949681423 3:6519019-6519041 CAGGTTCAGCTTAAGTTGTGTGG + Intergenic
952072046 3:29648955-29648977 CAACTTCACCACCTGTTTTGGGG + Intronic
952501159 3:33963379-33963401 CAAGTTATCCTAAAGTTTTGTGG + Intergenic
954915534 3:54146296-54146318 CAAGGTCACCTCGAGTGTAGTGG - Intronic
956776334 3:72568446-72568468 CAAGTTCACCTCCACTGTTCAGG + Intergenic
957775418 3:84752251-84752273 CCAGTACACCCCAAGTTTTTAGG + Intergenic
959505759 3:107154936-107154958 TAACTTCTCCTCAACTTTTGGGG + Intergenic
961623015 3:128239539-128239561 GAAGCCCACCTCAAGTTCTGAGG - Intronic
961981156 3:131080528-131080550 CAAGTTCCATGCAAGTTTTGTGG + Exonic
962220069 3:133557500-133557522 AAACTTCACCTCTAGTTTTTTGG - Intergenic
962423345 3:135247868-135247890 TGAGTCCACCACAAGTTTTGAGG + Intronic
962996546 3:140634363-140634385 CCAGTTTACCTGAAGTTTTCAGG - Intergenic
965137938 3:164798400-164798422 CAGGTTGACTTCAAGATTTGTGG - Intergenic
966971865 3:185051683-185051705 CAAGTTCACTTCATTTTTTAGGG - Intronic
969106853 4:4812942-4812964 CAAGTAAACATCAAATTTTGTGG - Intergenic
971067253 4:23047338-23047360 CACGTTCTCCTGTAGTTTTGAGG + Intergenic
971187231 4:24391208-24391230 CAAGTCAAACTCAAATTTTGCGG - Intergenic
971705946 4:30043289-30043311 CCACTTTACCTCAAATTTTGGGG + Intergenic
972990702 4:44819791-44819813 CAAGGTGACCTGAATTTTTGAGG + Intergenic
973832192 4:54772973-54772995 CAAATCCATTTCAAGTTTTGAGG + Intergenic
974684469 4:65208393-65208415 GAAGTTCACCTCATTGTTTGAGG + Intergenic
977080602 4:92522709-92522731 AAAGATAACTTCAAGTTTTGGGG + Intronic
981425525 4:144598086-144598108 CAAGTTCACTTGAAGATTTCAGG - Intergenic
983018428 4:162643685-162643707 AAAGTTCTCCTCACTTTTTGAGG - Intergenic
988000259 5:25338979-25339001 CAAGATGACTCCAAGTTTTGAGG + Intergenic
990474387 5:56147567-56147589 CAAGATGTTCTCAAGTTTTGTGG - Intronic
990699910 5:58463403-58463425 CATGTTCACGGCAACTTTTGAGG - Intergenic
992015642 5:72572869-72572891 CAATTTGACTTCAAGCTTTGTGG + Intergenic
994067147 5:95555784-95555806 CCAGTTCACCTCAAGTTTGCAGG + Intronic
994535539 5:101025419-101025441 CAATATCACCTCAAGACTTGGGG + Intergenic
994827390 5:104731985-104732007 AAATTTAACCACAAGTTTTGGGG + Intergenic
996564001 5:124860624-124860646 CAGGTCAACATCAAGTTTTGTGG + Intergenic
997193752 5:131963587-131963609 CAAGGTCATCTCCAGGTTTGGGG - Intronic
997776995 5:136618553-136618575 CAAGTGCACCTCAAGGTCAGGGG + Intergenic
1000538739 5:162512335-162512357 GAAATTTACCACAAGTTTTGTGG - Intergenic
1014138681 6:117916821-117916843 CAGCTTCACCTCAAGCTCTGAGG + Intronic
1016114923 6:140268951-140268973 CAAGTTCAATTCAATTATTGAGG + Intergenic
1016722840 6:147322809-147322831 CAAGTACACTTGAAGTTTTCTGG + Intronic
1017534024 6:155327447-155327469 GAAGGTCACCTCCAGTTCTGAGG + Intergenic
1019834927 7:3373881-3373903 CAAGTTTATTTCAAGTTTTTGGG - Intronic
1021614678 7:22489508-22489530 CAAGTTCACCTGAAGTCATCAGG + Intronic
1021908470 7:25360375-25360397 CAAGGTCACCTGAAATTTAGAGG - Intergenic
1027889082 7:83947656-83947678 CAAGTTCTCCTTGAGTTTTGTGG + Intergenic
1028014849 7:85695374-85695396 CAATTTTACCTGGAGTTTTGGGG - Intergenic
1028101425 7:86825396-86825418 CAAGTTCACTTGAAATCTTGTGG + Intronic
1028822420 7:95228068-95228090 CACACTCACCCCAAGTTTTGTGG - Intronic
1032669211 7:134068060-134068082 CCAGATCAGCTCAAGTTTAGTGG + Intergenic
1034474228 7:151273618-151273640 CCAGTTCACCTCAGGTGCTGGGG + Intronic
1036958929 8:13222722-13222744 CAAATACACCTAAATTTTTGAGG + Intronic
1038963982 8:32550835-32550857 CAAATTCACCCCAATTTTTCAGG - Intronic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1039219181 8:35309438-35309460 CAAGTTCTTCTCAGGATTTGTGG + Intronic
1044478196 8:92653250-92653272 CAAGTTCACCTTCAAATTTGGGG + Intergenic
1046999164 8:120556185-120556207 CAAGTTAAGCTCCAGTTTTGGGG + Intronic
1049908289 9:240167-240189 GAACTTTACCTCAAGTCTTGGGG + Intronic
1052725497 9:32223900-32223922 CAAATTAACCTTAATTTTTGAGG - Intergenic
1052799908 9:32957414-32957436 CAAATCCACTTCAAGATTTGGGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053130986 9:35615613-35615635 CAAGTTCACATCCAAATTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1058189152 9:101891826-101891848 CAGATTCACCTCCATTTTTGTGG + Intergenic
1058580933 9:106456244-106456266 TTAGTTCACCCCAATTTTTGAGG + Intergenic
1059683413 9:116608392-116608414 CAAGTTGCCCATAAGTTTTGAGG - Intronic
1060080679 9:120641513-120641535 TAAGTTGACCTTAGGTTTTGAGG + Intronic
1186734790 X:12450409-12450431 CAAGTTCATCTCATGTTGTAAGG + Intronic
1189304682 X:39978036-39978058 AAAGTACACCTCCATTTTTGAGG + Intergenic
1189457857 X:41210247-41210269 CAATTACACCACTAGTTTTGTGG + Intronic
1189898736 X:45683625-45683647 CAATTTCACCTGAAGTTTTAAGG - Intergenic
1193693758 X:84680951-84680973 CAACTTAAGCTCAAGGTTTGAGG + Intergenic
1194178181 X:90678263-90678285 CAAGTTCACATCAAATTTTGTGG - Intergenic
1195051050 X:101097425-101097447 CAAGTTTACCTAAAGTTTATAGG + Intergenic
1195996275 X:110734745-110734767 CAAGTTCACATGAAGATTTGAGG - Intronic
1198059129 X:133026192-133026214 CAGGTTTACCTCCAGCTTTGTGG + Exonic
1198937492 X:141913894-141913916 CTAGTTGACCTTAAGTTTGGTGG + Intergenic
1198961561 X:142188971-142188993 CTAGTTGACCTTAAGTTTGGTGG - Intergenic
1200524841 Y:4260411-4260433 CAAGTTCACATCAAATTTTGTGG - Intergenic
1200944945 Y:8825459-8825481 CAAAGTCACTTCAAATTTTGGGG + Intergenic
1200945092 Y:8827114-8827136 CAAGTTCACCTTCACTTATGTGG + Intergenic