ID: 1117437256

View in Genome Browser
Species Human (GRCh38)
Location 14:55728294-55728316
Sequence ACCTAACATAAGTGGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117437256_1117437260 3 Left 1117437256 14:55728294-55728316 CCATGGATCCACTTATGTTAGGT No data
Right 1117437260 14:55728320-55728342 TTTTTTTTTTTTTTTTGCAGGGG 0: 115
1: 1068
2: 10719
3: 113008
4: 134148
1117437256_1117437259 2 Left 1117437256 14:55728294-55728316 CCATGGATCCACTTATGTTAGGT No data
Right 1117437259 14:55728319-55728341 TTTTTTTTTTTTTTTTTGCAGGG 0: 134
1: 1316
2: 14375
3: 131799
4: 143066
1117437256_1117437258 1 Left 1117437256 14:55728294-55728316 CCATGGATCCACTTATGTTAGGT No data
Right 1117437258 14:55728318-55728340 TTTTTTTTTTTTTTTTTTGCAGG 0: 421
1: 4441
2: 30482
3: 124908
4: 135524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117437256 Original CRISPR ACCTAACATAAGTGGATCCA TGG (reversed) Intergenic
No off target data available for this crispr