ID: 1117444058

View in Genome Browser
Species Human (GRCh38)
Location 14:55786960-55786982
Sequence CTCCCTGGAAGAAGACCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117444058_1117444065 24 Left 1117444058 14:55786960-55786982 CCCACGGGTCTTCTTCCAGGGAG No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444058_1117444066 25 Left 1117444058 14:55786960-55786982 CCCACGGGTCTTCTTCCAGGGAG No data
Right 1117444066 14:55787008-55787030 TCTTAAGTGGGACCCTAACTGGG No data
1117444058_1117444063 12 Left 1117444058 14:55786960-55786982 CCCACGGGTCTTCTTCCAGGGAG No data
Right 1117444063 14:55786995-55787017 CTACAGCTTCAGCTCTTAAGTGG No data
1117444058_1117444064 13 Left 1117444058 14:55786960-55786982 CCCACGGGTCTTCTTCCAGGGAG No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117444058 Original CRISPR CTCCCTGGAAGAAGACCCGT GGG (reversed) Intergenic
No off target data available for this crispr