ID: 1117444064

View in Genome Browser
Species Human (GRCh38)
Location 14:55786996-55787018
Sequence TACAGCTTCAGCTCTTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117444053_1117444064 18 Left 1117444053 14:55786955-55786977 CCCACCCCACGGGTCTTCTTCCA No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data
1117444054_1117444064 17 Left 1117444054 14:55786956-55786978 CCACCCCACGGGTCTTCTTCCAG No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data
1117444059_1117444064 12 Left 1117444059 14:55786961-55786983 CCACGGGTCTTCTTCCAGGGAGA No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data
1117444051_1117444064 20 Left 1117444051 14:55786953-55786975 CCCCCACCCCACGGGTCTTCTTC No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data
1117444052_1117444064 19 Left 1117444052 14:55786954-55786976 CCCCACCCCACGGGTCTTCTTCC No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data
1117444057_1117444064 14 Left 1117444057 14:55786959-55786981 CCCCACGGGTCTTCTTCCAGGGA No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data
1117444050_1117444064 21 Left 1117444050 14:55786952-55786974 CCCCCCACCCCACGGGTCTTCTT No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data
1117444058_1117444064 13 Left 1117444058 14:55786960-55786982 CCCACGGGTCTTCTTCCAGGGAG No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data
1117444060_1117444064 -2 Left 1117444060 14:55786975-55786997 CCAGGGAGACTGCGTACCTCCTA No data
Right 1117444064 14:55786996-55787018 TACAGCTTCAGCTCTTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117444064 Original CRISPR TACAGCTTCAGCTCTTAAGT GGG Intergenic
No off target data available for this crispr