ID: 1117444065

View in Genome Browser
Species Human (GRCh38)
Location 14:55787007-55787029
Sequence CTCTTAAGTGGGACCCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117444058_1117444065 24 Left 1117444058 14:55786960-55786982 CCCACGGGTCTTCTTCCAGGGAG No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444060_1117444065 9 Left 1117444060 14:55786975-55786997 CCAGGGAGACTGCGTACCTCCTA No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444062_1117444065 -10 Left 1117444062 14:55786994-55787016 CCTACAGCTTCAGCTCTTAAGTG No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444052_1117444065 30 Left 1117444052 14:55786954-55786976 CCCCACCCCACGGGTCTTCTTCC No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444053_1117444065 29 Left 1117444053 14:55786955-55786977 CCCACCCCACGGGTCTTCTTCCA No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444061_1117444065 -7 Left 1117444061 14:55786991-55787013 CCTCCTACAGCTTCAGCTCTTAA No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444057_1117444065 25 Left 1117444057 14:55786959-55786981 CCCCACGGGTCTTCTTCCAGGGA No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444059_1117444065 23 Left 1117444059 14:55786961-55786983 CCACGGGTCTTCTTCCAGGGAGA No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data
1117444054_1117444065 28 Left 1117444054 14:55786956-55786978 CCACCCCACGGGTCTTCTTCCAG No data
Right 1117444065 14:55787007-55787029 CTCTTAAGTGGGACCCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117444065 Original CRISPR CTCTTAAGTGGGACCCTAAC TGG Intergenic
No off target data available for this crispr