ID: 1117445520

View in Genome Browser
Species Human (GRCh38)
Location 14:55800445-55800467
Sequence ATGGTGAGAGAAATCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117445517_1117445520 10 Left 1117445517 14:55800412-55800434 CCATGGCTTTGAAACTGCCTTTG No data
Right 1117445520 14:55800445-55800467 ATGGTGAGAGAAATCTGACATGG No data
1117445519_1117445520 -7 Left 1117445519 14:55800429-55800451 CCTTTGCAAAATTATGATGGTGA No data
Right 1117445520 14:55800445-55800467 ATGGTGAGAGAAATCTGACATGG No data
1117445516_1117445520 14 Left 1117445516 14:55800408-55800430 CCGGCCATGGCTTTGAAACTGCC No data
Right 1117445520 14:55800445-55800467 ATGGTGAGAGAAATCTGACATGG No data
1117445515_1117445520 15 Left 1117445515 14:55800407-55800429 CCCGGCCATGGCTTTGAAACTGC No data
Right 1117445520 14:55800445-55800467 ATGGTGAGAGAAATCTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117445520 Original CRISPR ATGGTGAGAGAAATCTGACA TGG Intergenic
No off target data available for this crispr