ID: 1117445911

View in Genome Browser
Species Human (GRCh38)
Location 14:55803801-55803823
Sequence GTGTCTAGATGGGTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117445905_1117445911 -1 Left 1117445905 14:55803779-55803801 CCCAGGGCTTTTGAAAGTAGGCG No data
Right 1117445911 14:55803801-55803823 GTGTCTAGATGGGTGGTGGAAGG No data
1117445903_1117445911 8 Left 1117445903 14:55803770-55803792 CCTGTTCTGCCCAGGGCTTTTGA No data
Right 1117445911 14:55803801-55803823 GTGTCTAGATGGGTGGTGGAAGG No data
1117445906_1117445911 -2 Left 1117445906 14:55803780-55803802 CCAGGGCTTTTGAAAGTAGGCGT No data
Right 1117445911 14:55803801-55803823 GTGTCTAGATGGGTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117445911 Original CRISPR GTGTCTAGATGGGTGGTGGA AGG Intergenic
No off target data available for this crispr