ID: 1117447743

View in Genome Browser
Species Human (GRCh38)
Location 14:55820876-55820898
Sequence GGACCCACCTGGAGTCCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117447743_1117447747 11 Left 1117447743 14:55820876-55820898 CCGATGGGACTCCAGGTGGGTCC No data
Right 1117447747 14:55820910-55820932 AACTTTGGAAATTTACTAAATGG No data
1117447743_1117447745 -4 Left 1117447743 14:55820876-55820898 CCGATGGGACTCCAGGTGGGTCC No data
Right 1117447745 14:55820895-55820917 GTCCACACAGTCAGCAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117447743 Original CRISPR GGACCCACCTGGAGTCCCAT CGG (reversed) Intergenic