ID: 1117449944

View in Genome Browser
Species Human (GRCh38)
Location 14:55840260-55840282
Sequence TCCATGGCGTGGAAGGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117449944_1117449949 29 Left 1117449944 14:55840260-55840282 CCTGTTGCCTTCCACGCCATGGA No data
Right 1117449949 14:55840312-55840334 TTCTGTTGCTGCTCACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117449944 Original CRISPR TCCATGGCGTGGAAGGCAAC AGG (reversed) Intergenic
No off target data available for this crispr