ID: 1117449949

View in Genome Browser
Species Human (GRCh38)
Location 14:55840312-55840334
Sequence TTCTGTTGCTGCTCACTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117449948_1117449949 13 Left 1117449948 14:55840276-55840298 CCATGGAAGGTTTGTTCTTTCGC 0: 5
1: 30
2: 59
3: 37
4: 129
Right 1117449949 14:55840312-55840334 TTCTGTTGCTGCTCACTCTTTGG No data
1117449944_1117449949 29 Left 1117449944 14:55840260-55840282 CCTGTTGCCTTCCACGCCATGGA No data
Right 1117449949 14:55840312-55840334 TTCTGTTGCTGCTCACTCTTTGG No data
1117449946_1117449949 22 Left 1117449946 14:55840267-55840289 CCTTCCACGCCATGGAAGGTTTG No data
Right 1117449949 14:55840312-55840334 TTCTGTTGCTGCTCACTCTTTGG No data
1117449947_1117449949 18 Left 1117449947 14:55840271-55840293 CCACGCCATGGAAGGTTTGTTCT No data
Right 1117449949 14:55840312-55840334 TTCTGTTGCTGCTCACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117449949 Original CRISPR TTCTGTTGCTGCTCACTCTT TGG Intergenic
No off target data available for this crispr