ID: 1117454266

View in Genome Browser
Species Human (GRCh38)
Location 14:55881994-55882016
Sequence TGGAACTGCCAGGCTCTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117454260_1117454266 5 Left 1117454260 14:55881966-55881988 CCACTGGTCTTCGAGGGTGACAG No data
Right 1117454266 14:55881994-55882016 TGGAACTGCCAGGCTCTGGTCGG No data
1117454259_1117454266 6 Left 1117454259 14:55881965-55881987 CCCACTGGTCTTCGAGGGTGACA No data
Right 1117454266 14:55881994-55882016 TGGAACTGCCAGGCTCTGGTCGG No data
1117454255_1117454266 24 Left 1117454255 14:55881947-55881969 CCAGGGGAGGAAAATGGACCCAC No data
Right 1117454266 14:55881994-55882016 TGGAACTGCCAGGCTCTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117454266 Original CRISPR TGGAACTGCCAGGCTCTGGT CGG Intergenic
No off target data available for this crispr