ID: 1117457483

View in Genome Browser
Species Human (GRCh38)
Location 14:55912490-55912512
Sequence TAGGAGCCCGGACATGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117457473_1117457483 10 Left 1117457473 14:55912457-55912479 CCAGGCCAGAGCGAGGACCGAGT No data
Right 1117457483 14:55912490-55912512 TAGGAGCCCGGACATGGGCATGG No data
1117457477_1117457483 5 Left 1117457477 14:55912462-55912484 CCAGAGCGAGGACCGAGTGGGGT No data
Right 1117457483 14:55912490-55912512 TAGGAGCCCGGACATGGGCATGG No data
1117457479_1117457483 -7 Left 1117457479 14:55912474-55912496 CCGAGTGGGGTGAGAGTAGGAGC No data
Right 1117457483 14:55912490-55912512 TAGGAGCCCGGACATGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117457483 Original CRISPR TAGGAGCCCGGACATGGGCA TGG Intergenic
No off target data available for this crispr