ID: 1117457761

View in Genome Browser
Species Human (GRCh38)
Location 14:55914809-55914831
Sequence AGCAATCATGTCTGTATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117457758_1117457761 18 Left 1117457758 14:55914768-55914790 CCCAAGTCTTCTTAGAAGAAGAA No data
Right 1117457761 14:55914809-55914831 AGCAATCATGTCTGTATCCCAGG No data
1117457757_1117457761 19 Left 1117457757 14:55914767-55914789 CCCCAAGTCTTCTTAGAAGAAGA No data
Right 1117457761 14:55914809-55914831 AGCAATCATGTCTGTATCCCAGG No data
1117457756_1117457761 20 Left 1117457756 14:55914766-55914788 CCCCCAAGTCTTCTTAGAAGAAG No data
Right 1117457761 14:55914809-55914831 AGCAATCATGTCTGTATCCCAGG No data
1117457759_1117457761 17 Left 1117457759 14:55914769-55914791 CCAAGTCTTCTTAGAAGAAGAAG No data
Right 1117457761 14:55914809-55914831 AGCAATCATGTCTGTATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117457761 Original CRISPR AGCAATCATGTCTGTATCCC AGG Intergenic
No off target data available for this crispr