ID: 1117459342

View in Genome Browser
Species Human (GRCh38)
Location 14:55929277-55929299
Sequence GATCTCTGCATGGAAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117459342_1117459350 14 Left 1117459342 14:55929277-55929299 CCCTTCCCTTCCATGCAGAGATC No data
Right 1117459350 14:55929314-55929336 CAATTGGCGAAAATGTAGTTGGG No data
1117459342_1117459347 -2 Left 1117459342 14:55929277-55929299 CCCTTCCCTTCCATGCAGAGATC No data
Right 1117459347 14:55929298-55929320 TCACTTCACATGTATCCAATTGG No data
1117459342_1117459349 13 Left 1117459342 14:55929277-55929299 CCCTTCCCTTCCATGCAGAGATC No data
Right 1117459349 14:55929313-55929335 CCAATTGGCGAAAATGTAGTTGG No data
1117459342_1117459351 17 Left 1117459342 14:55929277-55929299 CCCTTCCCTTCCATGCAGAGATC No data
Right 1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117459342 Original CRISPR GATCTCTGCATGGAAGGGAA GGG (reversed) Intergenic